Labshake search
Citations for Agilent :
1 - 50 of 1004 citations for 7 Hydroxy 4 methylcoumarin 3 acetic acid succinimidyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... (buffer A: 0.1% trifluoro-acetic acid in water, buffer B 100% acetonitrile with 0.1% trifluoro-acetic acid; Agilent Zorbax 300SB-C18 column). Collected protein fractions were lyophilized and stored at −20 °C.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Microbiology 2019Quote: ... The concentrations of the solvents (acetone, acetic acid, butyric acid, butanol, and ethanol) were determined using gas chromatography (7890A, Agilent, Wilmington, DE, USA). Isobutyl alcohol and isobutyric acid were used as the internal standards for solvent quantification.
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.3 μL of acetic acid was added to the sample before desalting with a C18 tip (Agilent A57203). The C18 tip was washed three times with 200 μL of methanol ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Microbiology 2021Quote: ... The extracted phospholipids were methanolized as fatty-acid methyl esters and then analysed using gas chromatography (Agilent Technologies 6890N, UK) [26] ...
-
bioRxiv - Developmental Biology 2021Quote: ... The biodiesel obtained was stored and the amount of fatty acid methyl esters (FAMEs) were determined using a gas chromatography mass spectrometer (GCMS)(Agilent systems). The conditions used include hydrogen as the carrier gas with a flow rate of 40ml/minutes ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: ... esters and 4-vinyl guaiacol concentrations were analysed using headspace solid phase micro-extraction coupled with gas chromatography (Agilent 7890A)- mass spectrometry (Agilent 5975C ...
-
bioRxiv - Zoology 2024Quote: ... The resulting esters were analyzed by Agilent GC-FID ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: Esters were measured by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2022Quote: Esters were quantified by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... CoA-esters were purified by using HPLC 1260 Infinity (Agilent), equipped with Gemini 10 μm NX-C18 110 Å Column (Phenomenex) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Fatty esters were analyzed on an Agilent GCMS 5975/7890 (Agilent Technologies) using an DB-35MS column ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sample pH was then adjusted to ~4 with formic acid prior to loading on Bond Elut-PH SPE columns (Agilent, 14102005), washing with aqueous buffer (30 mM ascorbic acid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample pH was then adjusted to 4 with 15 μL of 20% formic acid before loading onto conditioned SPE Bond-Elute pH columns (Agilent, 14102062) at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% medronic acid (Agilent), and Mobile phase B contained 90% acetonitrile and 0.1% medronic acid ...