Labshake search
Citations for Agilent :
1 - 50 of 1684 citations for 7 Chlorothieno 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2% Buffer B (0.1% formic acid in Optima grade acetonitrile (Fisher)) using a 1200 series capillary pump (Agilent). Following loading ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... B.08.00 (Agilent Technologies, USA). A patchoulol standard (18450 ...
-
bioRxiv - Immunology 2022Quote: ... b) c-KIT− (DAKO-MA512944) (Nagasawa et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... B.08.00 (Agilent Technologies, USA). The National Institute of Standards and Technology (NIST ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Plant Biology 2021Quote: ... Dried metabolites were methoximated (20 mg/mL methoxyamine in pyridine) and trimethylsilylated (MSTFA: TMSCI, 99:1) and then analyzed by GC-MS (Agilent 5975, GC/single quadrupole MS). GC-MS data were processed by Agilent MSD ChemStation ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Cell Biology 2020Quote: ... MassHunter version B.06.00 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Mass Hunter B.06.00 software (Agilent) was used to quantify isotopomer peak areas before natural abundance isotope correction was performed using an in-house algorithm.
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... B=90% acetonitrile in water, both A and B containing 10mM ammonium acetate pH 9.0 and 5μM Agilent’s deactivator additive ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A chiral GC column (Cyclosil-B, Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Qualitative Analysis B.06.00 software (Agilent Technologies) was used to export the m/z of precursor and product ions and retention time of target lipids in the multiple reaction monitoring data ...
-
bioRxiv - Physiology 2022Quote: ... release B.07.01 (Agilent Technology, Waldbronn Germany).
-
bioRxiv - Animal Behavior and Cognition 2019Quote: MassHunter Profinder B.08.00 (Agilent Technologies Inc.) was used to deconvolute ...
-
bioRxiv - Immunology 2019Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Immunology 2022Quote: ... for primary B cells 10mM glucose (Agilent), centrifuged at 200 x g at RT for 2 min without breaks and incubated for 30 min at 37°C in a CO2 –free incubator ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-CA125 epitope group B (Agilent, M11 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Qualitative Analysis (version B.06.00, Agilent). Using standard curve to calculate the citrate content in tissue samples ...
-
bioRxiv - Biochemistry 2019Quote: ... solvent A) and methanol:isopropanol (8:2 v/v, solvent B) was generated by an Infinity II 1290 UPLC (Agilent, Santa Clara, CA, USA) and with a constant flow rate of 600 μL min−1 (0 min ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were analysed with solid phase microextraction (SPME) GC-MS (Agilent 7890 B and 5977 B MSD, Agilent, Inc.) with a Gerstel multipurpose sampler (MPS ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were analysed with solid phase microextraction (SPME) GC-MS (Agilent 7890 B and 5977 B MSD, Agilent, Inc.) with a Gerstel multipurpose sampler (MPS ...
-
bioRxiv - Microbiology 2024Quote: ... Metabolites were analyzed using Agilent Qualitative Analysis B.07.00 and Profinder B.07.00 software (Agilent Technologies, Santa Clara, CA, USA) with a mass tolerance of <0.005 Da ...
-
bioRxiv - Biochemistry 2020Quote: ... B.06.01.6157 software (Agilent Technologies, Palo Alto, CA). All solvents were LC-MS grade (Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mass Hunter Workstation (ver. B.06.00, Agilent Technologies) software was used for data acquisition and analysis ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...