Labshake search
Citations for Agilent :
1 - 50 of 3135 citations for 7 Chloro 3 4 dihydro 1 2H isoquinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated for 2h at room temperature with Horse Radish Peroxidase (HRP)-conjugated αMouse antibodies (Dako). After washing with TBS-Tween ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibody incubation lasted 2h and was followed by avidin-biotin complexes for signal amplification (ABC kit, Dako). Immunoreactivities were visualized using 3,3’-diaminobenzidine as a chromogen ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
Suppression of the Integrated Stress Response in Islet β Cells Decreases Risk of Autoimmune DiabetesbioRxiv - Cell Biology 2023Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2h at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Cancer Biology 2021Quote: ... suspended in saline in 12 mm glass vials and 2H-MR spectra acquired using a 16 mm 2H single loop surface coil (DOTY Scientific) at a Varian 14.1T vertical MR scanner (Agilent Technologies). A pulse-acquire sequence (TR=260ms ...
-
bioRxiv - Cancer Biology 2022Quote: ... in a citrate buffer for 20 min at 95°C for TP53 (1:800, Dako, M7001 DO-7), BCL-10 (1:1000 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...