Labshake search
Citations for Agilent :
1 - 50 of 4473 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 5% phenyl-polymethylsiloxane capillary column (DB-5MS, 30 m × 0.25 mm × 1.0 μm; Agilent).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ON) mass spectrometer using a Eclipse Plus phenyl hexyl column (4.6 A 100mm, 5 µm column, Agilent) and 1290 Infinity II inline filter (0.3 µm) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Cell Biology 2021Quote: ... One microliter of the derivatized samples was injected into an Agilent 6890 GC interfaced to an Agilent 5973 quadrupole MS with a HP-5ms (5%-Phenyl)-methylpolysiloxane column (30 m × 0.25 mm × 0.25 μm, Agilent) in splitless mode ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Microbiology 2020Quote: ... Separation occurred with a HP-5 ms capillary column coated with 5% phenyl-95% methylpolysiloxane (30 m×250 µm i.d., 0.25 µm film thickness, Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... An HP-5MS capillary column (5%phenyl-methyl-siloxane, 30-m, 250-mm, and 0.25-mm film thickness; Agilent) was used with helium carrier gas at 2 mL/min ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Plant Biology 2024Quote: ... The organic phase was dried using anhydrous MgSO4 and analysed on GC-2010 Pro gas chromatograph (Shimadzu, Japan) equipped with an HP-5MS 30 m × 0.25 mm (5%-Phenyl)-methylpolysiloxane column (19091S-133, Agilent) with nitrogen as the carrier gas with splitless injection mode ...
-
bioRxiv - Microbiology 2023Quote: ... Poroshell 120 Phenyl Hexyl column (Agilent Technologies, USA) was used for separation ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Cell Biology 2022Quote: ... Derivatized samples were analyzed using an Agilent Technologies 7890B gas chromatographer with a HP-5MS 5% phenyl methyl Silox column (Agilent) coupled to an Agilent Technologies 5977A mass spectrometer ...
-
bioRxiv - Systems Biology 2023Quote: ... we used an Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 µm particle size, Agilent Technologies) and a Diode Array Detector (G4212 ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Bioengineering 2024Quote: ... Poroshell 120 Phenyl Hexyl column (Agilent Technologies, Santa Clara, CA) held at 40°C ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
Suppression of the Integrated Stress Response in Islet β Cells Decreases Risk of Autoimmune DiabetesbioRxiv - Cell Biology 2023Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...