Labshake search
Citations for Agilent :
1 - 50 of 3885 citations for 7 Chloro 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
Suppression of the Integrated Stress Response in Islet β Cells Decreases Risk of Autoimmune DiabetesbioRxiv - Cell Biology 2023Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...