Labshake search
Citations for Agilent :
1 - 50 of 993 citations for 7 CYANO 4 HYDROXY 3 QUINOLINECARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sample pH was then adjusted to ~4 with formic acid prior to loading on Bond Elut-PH SPE columns (Agilent, 14102005), washing with aqueous buffer (30 mM ascorbic acid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample pH was then adjusted to 4 with 15 μL of 20% formic acid before loading onto conditioned SPE Bond-Elute pH columns (Agilent, 14102062) at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% medronic acid (Agilent), and Mobile phase B contained 90% acetonitrile and 0.1% medronic acid ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Molecular Biology 2020Quote: - Medronic acid (Cat# 5191-3940, Agilent Technologies)
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...