Labshake search
Citations for Agilent :
1 - 50 of 4253 citations for 7 CHLORO 2H PYRIDO 2 3 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Molecular Biology 2022Quote: ... amplified and labeled with Cyanine 3 (Cy3) as instructed by the manufacturer of the One-Color Agilent Low Input Quick Amp Labeling Kit (Agilent Technologies, Les Ulis, France). Cy3-labeled cRNA was hybridized onto Agilent Whole Human Genome Oligo 8×60K V2 Arrays (SurePrint G3 Human Gene Expression 8×60K v2 Microarray Kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...