Labshake search
Citations for Agilent :
1 - 50 of 754 citations for 7 Benzyloxy 1H indazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Blocking was performed by 1h incubation in humid chamber with 3% of normal donkey serum (Vendor) in blocking solution (DAKO). Slides were incubated in humid chamber with primary antibodies overnight at 4°C and washed in PBS 0.2% Triton-X100 ...
-
bioRxiv - Microbiology 2022Quote: ... Online mass axis correction was performed with purine and hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). The source gas temperature of the ESI ion source was 225 °C ...
-
bioRxiv - Immunology 2019Quote: ... as internal standard were analyzed by 1D 1H and 1H{13C}-HSQC NMR on a 14.1 T DD2 NMR spectrometer (Agilent Technologies, CA). 1D 1H spectra were acquired using the standard PRESAT pulse sequence with 512 transients ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). After processing of raw data as previously described24 ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated 1h with HRP-conjugated secondary antibodies (DAKO, 1:2000) in 1X TBS-Tween containing 5% non-fat dry milk ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were blocked for 1h with serum-free block (Dako, X0909), and incubated over-night with our custom-made DDX5 antibodies (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Complete imidazolinone conversion was checked by 1H-NMR (MR400 MHz, Agilent) For the reversal tests ...
-
bioRxiv - Developmental Biology 2020Quote: ... and rabbit anti-Lysozyme antibody (A0099, DAKO 1:1000 (Fig. 1h), GTX72913 ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NMR spectroscopic data (1H, 13C, HSQC, COSY, and HMBC) were collected by Agilent 600 MHz (14.1 Tesla ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting polymers were characterized by 1H NMR in CDCl3 and SEC (Agilent Infinity 1200 HPLC ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Genomics 2020Quote: ... After incubation with HRP-conjugated secondary antibodies (1:5000, DAKO p0260 and p0217, 1h at RT), bands or dots were imaged on a chemiluminescence detection system (Bio-rad).
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: 1H NMR experiments were carried out on a Varian UNITY INOVA 500 spectrometer (Agilent Technologies, CA, USA). 1H NMR spectra were recorded using a 1D-NOESY pulse sequence with a mixing time of 1 ms and a recycle time of 3.5 s ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse immunoglobulins (diluted 1:1000, room temperature, 1h reaction, Dako) were used as the secondary antibody.
-
bioRxiv - Systems Biology 2022Quote: 1H NMR experiments were carried out on a Varian UNITY INOVA 500 spectrometer (Agilent Technologies, CA, USA) operating at 499.839 MHz ...
-
bioRxiv - Systems Biology 2023Quote: 1H NMR experiments were carried out on a Varian UNITY INOVA 500 spectrometer (Agilent Technologies, CA, USA) operating at 499.839 MHz ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated for 1h at RT with the secondary antibody (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Dako; Polyclonal Goat Anti-Mouse Immunoglobulins/HRP ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.1% medronic acid (Agilent), and Mobile phase B contained 90% acetonitrile and 0.1% medronic acid ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: 1H-NMR spectra were obtained using a Varian® NMR 400 MHz Spectrometer (Agilent Inc., Palo Alto, CA, USA) at 25 °C and were used to confirm the purity of remdesivir in the TFF powders ...
-
bioRxiv - Microbiology 2021Quote: ... they were then washed three time in PBS containing 0.1% tween 20 and incubated 1h with a rabbit anti-mouse antibody conjugated with horseradish peroxidase (HRP) (Dako). The activity of HRP was revealed by enhanced chemiluminescence (Perkin-Elmer).
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Developmental Biology 2020Quote: ... antibody staining was carried out using an anti-RFP antibody for 1h detected with EnVision HRP anti-rabbit secondary (Agilent) followed by incubation with Tyramide-conjugated Opal 570 (PerkinElmer ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed 3 times 15 minutes with TBST before a 1h incubation of horseradish peroxidase (HRP)-conjugated antibodies (P0447 goat anti-mouse IgG HRP, Dako, 1:2500 or P0399 swine anti-rabbit IgG HRP ...