Labshake search
Citations for Agilent :
1 - 50 of 1106 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... the analysis was performed using one color SurePrint G3 Human GE 8×60k Microarrays (Agilent Technologies), and the data is available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA labeling was done either with a two-color Quick Amp Labeling Kit (4×44K arrays) or with a one-color Low Input Quick Amp Kit (8×60K arrays) according the supplier’s recommendations (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Genetics 2021Quote: ... and cultured chondrocytes of children (six girls and six boys) using catalog one-color microarrays (SurePrint G3 Human Gene Expression microarray, 8 × 60 k format; Agilent Technologies, Santa Clara, CA, USA). The data were analyzed using GeneSpring software (version 14.9 ...
-
bioRxiv - Microbiology 2022Quote: ... 8×15K (Agilent) was customized in order to include different sets of probes as indicated elsewhere (Beites et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Cell Biology 2019Quote: ... One-Color (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... one color (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 U/mL (Prozyme) – 400 U/mL (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
bioRxiv - Molecular Biology 2021Quote: ONE-seq libraries from Agilent Technologies were resuspended in 10 mM tris buffer and amplified in a 100 µL reaction containing 2 µL of 5 nM library ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were washed twice with PBS + 0.5% Triton X-100 and then rinsed one time with PBS before mounting with DAKO Fluorescence Mounting Medium (S3023; Dako NA Inc.). Images were analyzed with a Nikon Eclipse Ti fluorescence microscope with a Plan Fluor 40 Å∼ /1.30 Oil DIC N2 objective ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µm HPLC column (Agilent) at 60°C with a flow rate of 0.7 mL/min using 0.005 M H2SO4 in ddH2O as eluent ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: ... 8 µm HPLC column (Agilent Technologies). Samples of culture supernatants were diluted twice with milliQ water with 50 mM H2SO4 ...
-
bioRxiv - Genetics 2023Quote: ... or goat serum (DAKO, cat.no.X090210-8), followed by incubation with primary antibody (overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 µm HPLC column (Agilent Technologies). Analyses were performed using the following conditions ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-Mouse Envision-HRP (DAKO, one hour) as secondary antibody ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... closed with one-component-closure-caps (Agilent) at -80°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Systems Biology 2019Quote: ... 8×60K (v21) microarray slides (Agilent, UK) according to Agilent microRNA Hybridization Kit protocol (Agilent ...
-
bioRxiv - Systems Biology 2023Quote: DNA oligonucleotide libraries (one for functional screen and one for massively parallel mutagenesis analysis) consisting of 7500 sequences total were synthesized by Agilent. The second strand was synthesized using Klenow Fragment (3’ → 5’ exo- ...
-
bioRxiv - Cell Biology 2019Quote: ... one XFp Extracellular Flux Cartridge (Agilent Cat. #102983) was hydrated with Agilent Seahorse XF Calibrant (Agilent Cat ...
-
bioRxiv - Cell Biology 2019Quote: ... One Agilent cell culture miniplate (Agilent Cat. #102984) was coated with Corning Cell-Tak Cell and Tissue Adhesive (Corning Cat ...
-
bioRxiv - Genetics 2020Quote: ... Oligos were purchased as one pool from Agilent Technologies.
-
bioRxiv - Biophysics 2020Quote: ... DNA fragments: one from the pBlueScriptIISK+ plasmid (Stratagene) and the other from the pNLrep plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... One Color (Agilent Technologies, Part Number: 5190-0442). 500ng of each sample were denatured along with WT primer with a T7 polymerase promoter ...