Labshake search
Citations for Agilent :
1 - 50 of 4457 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight at 4 °C with the primary antibody: GFAP (Agilent/Dako, z033420-2, dilution 1:750) or MOG (Sigma-Aldrich ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...