Labshake search
Citations for Agilent :
1 - 50 of 2228 citations for 6H Thieno 2 3 b pyrrole 5 carboxylicacid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Zoology 2024Quote: ... The resulting esters were analyzed by Agilent GC-FID ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2020Quote: ... were separated by a gradient elution from 5% solvent B to 95% solvent B over 15 min on a high-capacity nano-LC chip (Agilent Technologies; part no. G4240-62010) driven by a 1200 series nano-flow HPLC system (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 5 minutes of re-equilibration at 0% B (Agilent 1290 Infinity LC system). Post-column ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Synthetic Biology 2019Quote: Esters were measured by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2022Quote: Esters were quantified by GC (HP 6890, Agilent, CA, USA) equipped with a MS (HP 5973 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... CoA-esters were purified by using HPLC 1260 Infinity (Agilent), equipped with Gemini 10 μm NX-C18 110 Å Column (Phenomenex) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2% Buffer B (0.1% formic acid in Optima grade acetonitrile (Fisher)) using a 1200 series capillary pump (Agilent). Following loading ...
-
bioRxiv - Plant Biology 2021Quote: ... together with mass and retention time alignment (0.1 min and 5 ppm respectively) were done in Profinder B.07 software (from Agilent Technologies). Annotation was done based on the ‘find-by-formula’ algorithm ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Fatty esters were analyzed on an Agilent GCMS 5975/7890 (Agilent Technologies) using an DB-35MS column ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Bioengineering 2022Quote: ... B.08.00 (Agilent Technologies, USA). A patchoulol standard (18450 ...
-
bioRxiv - Immunology 2022Quote: ... b) c-KIT− (DAKO-MA512944) (Nagasawa et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... B.08.00 (Agilent Technologies, USA). The National Institute of Standards and Technology (NIST ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... MassHunter version B.06.00 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... Mass Hunter B.06.00 software (Agilent) was used to quantify isotopomer peak areas before natural abundance isotope correction was performed using an in-house algorithm.
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... B=90% acetonitrile in water, both A and B containing 10mM ammonium acetate pH 9.0 and 5μM Agilent’s deactivator additive ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A chiral GC column (Cyclosil-B, Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Qualitative Analysis B.06.00 software (Agilent Technologies) was used to export the m/z of precursor and product ions and retention time of target lipids in the multiple reaction monitoring data ...
-
bioRxiv - Physiology 2022Quote: ... release B.07.01 (Agilent Technology, Waldbronn Germany).
-
bioRxiv - Animal Behavior and Cognition 2019Quote: MassHunter Profinder B.08.00 (Agilent Technologies Inc.) was used to deconvolute ...
-
bioRxiv - Immunology 2019Quote: ... MassHunter Workstation (B.06.00 SP01, Agilent Technologies) was used for metabolite identification by comparison of retention times ...
-
bioRxiv - Immunology 2022Quote: ... for primary B cells 10mM glucose (Agilent), centrifuged at 200 x g at RT for 2 min without breaks and incubated for 30 min at 37°C in a CO2 –free incubator ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-CA125 epitope group B (Agilent, M11 ...
-
bioRxiv - Neuroscience 2023Quote: ... and Qualitative Analysis (version B.06.00, Agilent). Using standard curve to calculate the citrate content in tissue samples ...