Labshake search
Citations for Agilent :
1 - 50 of 2830 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (S236784-2, DAKO, Carpinteria, CA, USA), for 20 min in a microwave oven ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA integrity values of 9-10 (Bioanalyzer, Agilent Technologies). Gene-specific primers and dual-labelled probes (labelled with 6-carboxyfluorescein and BHQ-1 ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse methyl capture sequencing (Methyl-Seq) libraries were generated using the SureSelectXT Methyl-Seq Target Enrichment System (Agilent, Santa Clara, CA, USA, #G9651B) and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Biochemistry 2019Quote: ... OCR and ECAR were measured 3 times every 9 minutes using a XFe96 Analyzer (Seahorse Bioscience) at a baseline and after addition of each drug ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH 9 (Dako) and endogenous peroxidase activity was blocked using 3% hydrogen peroxide ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were centrifuged (20,000 x g for 10 min) and desalted using 5 uL C18 cartridges on the AssayMap BRAVO platform (Agilent Technologies). For each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cell Biology 2021Quote: ... except that in this case the cDNA was synthesized from 1 µg (testis) or 13-20 ng (spermatozoa) of RNA using the AccuScript High-Fidelity 1st Strand cDNA Synthesis Kit (Agilent 200820) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... An HP-5MS capillary column (5%phenyl-methyl-siloxane, 30-m, 250-mm, and 0.25-mm film thickness; Agilent) was used with helium carrier gas at 2 mL/min ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent S2367). The chamber was heated to 125 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 9 (both Dako), endogenous peroxidase activity was blocked using 3% hydrogen peroxide and sections were blocked in PBS with 10% FBS (blocking buffer ...