Labshake search
Citations for Agilent :
1 - 50 of 4565 citations for 6 Oxabicyclo 3.1.0 hexane 2 ethanol 4 4 difluoro 3 hydroxy 1S 1 α 2 bta 3 bta 5 α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse monoclonal anti-α-SMA (M085129-2, Dako), Secondary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-α smooth muscle actin (α-sma) (1:50) (M0851, Dako) or anti-SSTR2 (1:50 ...
-
bioRxiv - Biochemistry 2023Quote: ... with α-fucosidase (bovine kidney from Sigma-Aldrich or almond α1,3/4-specific from Prozyme), α-mannosidase (jack bean from Sigma) ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Immunology 2020Quote: ... 500 ng of F(ab’)2 fragments of α-μ (clone JDC-15; Dako [α-human] ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and α(1–2,3,6) mannosidase (Prozyme). All exoglycosidase digests were carried out at 37 °C and at the reaction conditions recommended by the respective enzyme supplier ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse α CD45 (1:50; DAKO), and rabbit α Iba-1 (1:800 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1:2000 α- pan-HSV1 (#B011402, Dako), 1:2000 α-HSV1-ICP0 (#11060 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit α-GFAP (1:250, Dako Z0334), mouse α-PCNA (1:500 with antigen retrieval ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-α-sma (1:2500) (M0851, Dako), anti-SSTR2 (1:2500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT.
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT.
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody (α-rabbit Dako #P0448, α-mouse Dako #P0447) was diluted 1:2000 in 5% BSA/TBS-T and incubated for 1h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit (dk)-α-goat (1:200; DAKO). The following secondary antibodies were used for immunofluorescence ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Pathology 2020Quote: ... rabbit α-GFAP (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Neuroscience 2020Quote: ... or α-mouse-HRP (Dako) (1:10000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse α-PCNA (1:500 with antigen retrieval, Dako M087901), rabbit α-L-Plastin (1:1000 ...
-
bioRxiv - Plant Biology 2024Quote: ... and secondary antibodies α-mouse-HRP (Agilent, P0260, 1:5000), α-rat-HRP (GE HealthCare ...
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2022Quote: ... or α-rabbit-HRP (P0447, Dako). Blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Biophysics 2019Quote: ... smooth muscle α-actin (DAKO, M0851) 1:100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by HRP-conjugated α-rabbit (1:2000; Agilent Dako-P0448) secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-smooth muscle alpha-actin (α-SMA - Dako GA611, 1:100), anti-ACE2 (Merck SAB3500346 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by HRP-conjugated α-rabbit (1:2000; Agilent Dako-P0448) secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by HRP-conjugated α-rabbit (1:2000; Agilent Dako-P0448) secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by HRP-conjugated α-rabbit (1:2000; Agilent Dako-P0448) secondary antibody ...