Labshake search
Citations for Agilent :
1 - 50 of 3531 citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Primary secondary amines (PSA) and C18 endcapped SPE bulk sorbents were purchased from Agilent technologies (Santa Clara ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... The primary secondary amine (PSA) for dispersive solid phase extraction (dSPE) was acquired from Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cancer Biology 2019Quote: ... pH 6 (Dako) for 7 min in an IHC microwave ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 6 (DAKO), for 10 min in a pressure cooker ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Molecular Biology 2019Quote: ... Tryptic peptides were re-dissolved in 10 μl 5% formic acid and 6 μl was injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies) followed by an initial wash step with Buffer A (5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... using miR30-adapted sequences (5-6 shRNAs per target) by PCR-cloning a pool of oligonucleotides synthesized on 55k customized arrays (Agilent Technologies) using a well-established system 84–87 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2019Quote: ... pH 6 (Dako Cytomation) and set to 125°C with 30 s at the maximal pressure set to 10 psi ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 6 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Immunology 2020Quote: ... CK5/6 (Dako/IR780), p40 (Zytomed/MSK097) ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Synthetic Biology 2021Quote: 384 well qPCR reaction plates for the multiplexed activation of endogenous genes (Figure 5 and 6) were set up using the Brilliant II SYBR master mix (Agilent cat #600828) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...