Labshake search
Citations for Agilent :
1 - 50 of 1213 citations for 6 Chloro N methyl pyrimidine 4 5 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse methyl capture sequencing (Methyl-Seq) libraries were generated using the SureSelectXT Methyl-Seq Target Enrichment System (Agilent, Santa Clara, CA, USA, #G9651B) and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... For purines and pyrimidines metabolites ESI positive mode was used and analyzed using a 6495B triple quadrupole mass spectrometer (Agilent Technologies) coupled to a HPLC system (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Plant Biology 2019Quote: ... An HP-5MS capillary column (5%phenyl-methyl-siloxane, 30-m, 250-mm, and 0.25-mm film thickness; Agilent) was used with helium carrier gas at 2 mL/min ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Cell Biology 2022Quote: ... Derivatized samples were analyzed using an Agilent Technologies 7890B gas chromatographer with a HP-5MS 5% phenyl methyl Silox column (Agilent) coupled to an Agilent Technologies 5977A mass spectrometer ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were counter-stained in methyl green (Dako). Specimens were then dehydrated in series of ethanol and xylene ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2019Quote: ... Hybridized arrays were scanned at 5 μm resolution on a Microarray Scanner (Agilent p/n G2565BA). Data extraction from images was done by using Agilent Feature Extraction (FE ...
-
bioRxiv - Developmental Biology 2023Quote: ... was used to produce Methyl-Seq libraries using a SureSelectXT Methyl-Seq Target Enrichment System with a mouse enrichment panel (Agilent #G9651B and #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent, #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Biochemistry 2023Quote: ... The resulting 1-O-methyl-glycoside TMS derivatives were analysed by GC-MS (Agilent Technologies ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Cancer Biology 2019Quote: ... pH 6 (Dako) for 7 min in an IHC microwave ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 6 (DAKO), for 10 min in a pressure cooker ...
-
bioRxiv - Plant Biology 2019Quote: ... The resulting fatty acid methyl esters were analyzed using GC/MS (Agilent Technologies, Wilmington, DE) equipped with a capillary DB-23 column (30 m × 0.25 mm × 0.25 μm ...