Labshake search
Citations for Agilent :
1 - 50 of 3049 citations for 6 Benzofurancarboxamide N 1R 3R 4S 1 azabicyclo 2.2.1 hept 3 yl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Plant Biology 2019Quote: ... Additional synthetic SlMai1 variants were generated by PCR amplification using oligonucleotides encoding the amino acid changes followed either by BP Clonase recombination (for G2A and C3/4S mutants) or using the QuickChange Site-Directed Mutagenesis kit (for K91M; Agilent, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Biophysics 2021Quote: Wild-type (WT) 3RS-and 4RL-Tau constructs were expressed in BL21 CodonPlus(DE3)-RP Escherichia coli cells (Stratagene, La Jolla, CA) and purified as previously described [17 ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-IgK (Clone: N/A; 1:4000; Agilent; #A0191). Optimization of the antibodies and staining conditions was carried out on sections of human tonsil ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:1000, ab183741, abcam; n-Myc: 1:500, 51705 Cell Signaling Technology; CD45: 1:1000, 70257 Cell Signaling Technology; CD3: 1:2000 A0452 Dako/Agilent) diluted in TBST+5% goat serum in a humid chamber overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... pH 6 (Dako) for 7 min in an IHC microwave ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 6 (DAKO), for 10 min in a pressure cooker ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2019Quote: ... pH 6 (Dako Cytomation) and set to 125°C with 30 s at the maximal pressure set to 10 psi ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 6 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Immunology 2020Quote: ... CK5/6 (Dako/IR780), p40 (Zytomed/MSK097) ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Bioengineering 2019Quote: N-linked glycans were released from purified antibody samples by overnight incubation with N-Glyccosidase F (Prozyme, GKE-5006B). The proteins were removed using LudgerClean glycan EB-10 cartridges (Ludger ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat N° R37605) for 20 min and coverslips were mounted with Fluorescence Mounting Medium (Dako, Glostrup, Denmark, Cat N° S3023), while wells in the device were sealed with one drop of mounting medium per well before acquiring images ...
-
bioRxiv - Cancer Biology 2019Quote: ... citrate pH 6 (Agilent Technologies). Slides were immersed with blocking solution (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Biochemistry 2022Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...