Labshake search
Citations for Agilent :
1 - 50 of 1565 citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... 4 μg of total RNA with an RNA Integrity Number (RIN) ≥ 8 (Bioanalyzer 2100, Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Systems Biology 2019Quote: ... An amount of 100 ng of total RNA was hybridised with Cy-3 and subsequently hybridised on microarrays (SurePrint G3 8×60K, Agilent). The raw fluorescence signals were scanned with DNA Microarray Scanner SureSelect (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Microbiology 2022Quote: ... 8×15K (Agilent) was customized in order to include different sets of probes as indicated elsewhere (Beites et al. ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Microbiology 2020Quote: ... Amino acid analysis was performed by HPLC (Agilent 1100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tissue sections were incubated with 4% bovine serum albumin (BSA) and 8% serum in 1x wash buffer ‘en vision’ (Dako) to eliminate non-specific protein binding sites ...
-
bioRxiv - Biophysics 2020Quote: ... Calibration curves of individual and mixed amino acids were prepared using either 250 pmol stocks of corresponding individual amino acids or a 250 pmol amino acid standard mix (Agilent #5061-3331). Quantification was performed using calibration curves of the respective amino acid standards.
-
bioRxiv - Bioengineering 2024Quote: ... 8 U/mL (Prozyme) – 400 U/mL (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... The concentration of amino acids was determined by Agilent 1260 HPLC system ...
-
bioRxiv - Cancer Biology 2019Quote: Microarray experiments were performed as dual-color or single-color hybridizations on either Agilent Whole Human Genome 4×44K microarrays (Design ID 014850) or 8×60K human custom (Agilent-048908) microarrays comprising identical features for coding genes ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µm HPLC column (Agilent) at 60°C with a flow rate of 0.7 mL/min using 0.005 M H2SO4 in ddH2O as eluent ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Microbiology 2019Quote: ... The obtained BALF was concentrated using 5 kDa cutoff 4 ml spin concentrator (Agilent Technologies, USA) before infectivity experiments.
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...