Labshake search
Citations for Agilent :
1 - 50 of 6356 citations for 17 Hydroxyprogesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fluorescence was monitored for 17 h using a Cytation 5 device (BioTek, Agilent, Winooski, VT, USA). Excitation was provided by a monochromator ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Cancer Biology 2022Quote: ... HPTS and RuBPY fluorescence were monitored for 17 h using a Cytation 5 device (BioTek, Agilent, Winooski, VT, USA). Excitation was provided by a monochromator ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Immunology 2021Quote: ... the following mutations were introduced into the BG505 SOSIPv5.2 construct(17) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent): P240T ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Biophysics 2022Quote: ... or aged samples (T ~ 24 hours) were imaged directly in sealed 384-well microwell plates with a BioTek Cytation Gen 5 imaging plate reader (Agilent) using a 20 x objective ...
-
bioRxiv - Cancer Biology 2020Quote: ... and cRNA was hybridized with ArrayXS Human (Oaklabs, Germany) at 65 °C for 17 hours using the Agilent Gene Expression Hybridization Kit (Agilent Technologies, USA), washed once with Agilent Gene Expression Wash Buffer 1 for one minute at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: 5 × 104 cells were plated on XF24 cell culture plate (Agilent, no. 100777-004) with DMEM supplemented with 1 % FBS ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed plates were scanned using the high-content imaging system Cytation 5 (Agilent), with either the GFP channel for rVSV-S or the Texas red channel for rSARS-CoV-2 virus ...
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... in order to modify its DAG discrimination capacity 17 by replacing Gly652 with Ala (G652A) using the Quick-Change XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the oligonucleotides described in Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: 96-well plates containing single-cell clones were imaged on a Cytation 5 microscope (Agilent) 10 days after sorting ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then placed in a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent) and incubated at 37 °C for 3 hours ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Compound incubated plates and basal plates were then washed with assay media (Seahorse XF DMEM assay media kit (Agilent; #103575-100), 10 mM glucose ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: All kinetic data were obtained using either a BioTek Synergy H1 or Cytation 5 plate reader (Agilent Technologies). HEX was measured with an excitation peak of 533 nm and an emission peak of 559 nm with a gain of 80 to 100 to ensure fluorescence values were within the linear range of detection ...
-
bioRxiv - Neuroscience 2023Quote: ... The plate was thoroughly washed 5 times with PBS-T and 100 μL of TMB-Blue substrate (DAKO) was added followed by incubation in the dark for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the plate containing the follicles was transferred to a live-cell imaging system (Agilent BioTek Cytation 5, USA) to capture images at 6-minute intervals during ovulation ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... After centrifugation plate was incubated for 5 minutes before being loaded into a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Basal respiration was measured over six hours with 36 ten-minute protocol cycles including a ...
-
bioRxiv - Biochemistry 2023Quote: ... Colonies were stained with Wright-Giesma and plates were scanned using the Biotek Cytation 5 Imaging Multimodal Reader (Agilent). From scanned images ...
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Immunology 2021Quote: ... The derivative was injected into the GC/MS equipped with a DB-17 column (Agilent Technologies) and measured in SIM mode monitoring ions m/z 435 (M+0) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were spun down 500 g for 5 min followed by sealing with optical clear permanent seal (Agilent, 24212-001) using the Plateloc Thermal Microplate Sealer (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The luminescence signal which represents the amount of ATP in viable cells was measured with a microtiter well plate reader (BioTek Cytation 5, Agilent).
-
bioRxiv - Cancer Biology 2023Quote: 250 M10M6-PtenC124S cells and 750 M10M6-PtenWT cells were seeded in 384 well plate with 40 µL RPMI-1640 medium containing 5% FBS using Bravo automated liquid handling platform (Agilent). After 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Genomics 2021Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for an additional 20 min allowing cells to settle on the pre-dispensed gel ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluorescence was quantified using an excitation of 530/15 nm and emission of 590/15 nm on a fluorescent plate reader (BioTek Cytation 5, Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... DMMB solution was added (200 µL/well) and absorbance was measured at 540 nm and 590 nm using a plate reader (BioTek Cytation 5, Agilent Technologies). For all samples ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were sealed using a PlateLoc plate sealer (Agilent) with optical clear seal ...
-
bioRxiv - Genomics 2020Quote: ... Hybridisations were carried out over 17 hours at 65° C at 10rpm rotation and washed following manufacturer’s instructions (Agilent). Datasets are available at ArrayExpress ...
-
bioRxiv - Bioengineering 2022Quote: ... and the plates were incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). The liquid cultures were centrifuged at 3500 rpm for 5 minutes (Sorvall Legend X1R M20 rotor ...
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). 108 colony-forming units (CFUs ...
-
bioRxiv - Bioengineering 2024Quote: ... and the plates were incubated at 37°C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...