Labshake search
Citations for Agilent :
1001 - 1050 of 3005 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10 mM Glucose (Agilent, 103577), 2 mM Sodium Pyruvate (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-CK17 (1:10, Dako, M7046), mouse anti-MMP7 (1:100 ...
-
The Batten disease protein CLN3 is important for stress granules dynamics and translational activitybioRxiv - Molecular Biology 2022Quote: ... and 10 mM glucose (Agilent # 103681-100). Oligomycin and FCCP were reconstituted to concentrations of 10 μM and 5 μM ...
-
bioRxiv - Immunology 2020Quote: ... and treated with glucose (10 mM; Agilent), Oligomycin (1.5 μM) ...
-
Independent somatic evolution underlies clustered neuroendocrine tumors in the human small intestinebioRxiv - Genomics 2021Quote: ... anti-serotonin (H209; Dako; diluted 1:10) and anti-SSTR2 (UMB-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL OMIX C18 tips (Agilent Technologies) were used for desalting and microextraction of tryptic peptides ...
-
bioRxiv - Microbiology 2022Quote: ... coli Ultracompetent cells (XL-10 gold, Agilent) and plated onto Amp+ LB plates ...
-
bioRxiv - Neuroscience 2022Quote: ... or XL-10 Gold (Agilent Technology, 200314) competent cells were used for plasmid amplification.
-
bioRxiv - Cancer Biology 2022Quote: ... Counterstaining was performed with 10% haematoxylin (Dako) and after dehydration slides were mounted with DPX mounting medium (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... and additional 10 mM glutamine (Agilent, 103579).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... MassHunter Quant software version 10 from Agilent was used for data processing ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 mM glucose (Agilent Technologies, UK), and myoblasts were incubated at 37°C in a non-CO2 incubator 1 hour prior the experiment ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10 mM glucose (Agilent, 103577-100). Cells were then placed into a non-CO2 humidified incubator at 37°C for 60 min ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Biochemistry 2019Quote: ... cGAMP was purified from the crude reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Biochemistry 2019Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 × 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Immunology 2021Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNA concentration (estimated by Nanophotometer NP80, Implen) and RNA integrity number (RIN > 8) were determined (by BioAnalyzer 2100, Agilent Technologies Inc.). RNA was sequenced (from nine RNA samples ...
-
bioRxiv - Genomics 2024Quote: Array-based comparative genomic hybridization (aCGH) was performed using SurePrint G3 Human CGH 8×60K microarrays (Agilent Technologies, Santa Clara, CA, USA) with 41 kb overall median probe spacing according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene expression analysis was performed using an Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, Santa Clara, CA, USA) using an Agilent Single Color Labeling Kit (Low Input Quick Amp Labeling Kit 034949 ...
-
bioRxiv - Molecular Biology 2023Quote: ... seedlings were exposed on the plates to 8 kJ/m2 UV-C light in a Stratalinker 2400 (Stratagene, La Jolla, California, US) and transferred back into growth chamber for 5 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... cGAMP was purified from the reaction mixture using a PLRP-S polymeric reversed phase preparatory column (100 Å, 8 μm, 300 x 25 mm; Agilent Technologies) on a preparatory HPLC (1260 Infinity LC system ...
-
bioRxiv - Immunology 2023Quote: ... the purity and integrity (threshold RNA Integrity Number >8) of isolated total RNA was determined by microfluidic spectrophotometry on the 2100 Bioanalyzer (Agilent Technologies, USA). RNA-seq libraries were generated via mRNA isolation from total RNA by polyA-positive selection using the TruSeq™ RNA/DNA Library Preparation Kit (Illumina #RS-122-2001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endogenous peroxidase activity was blocked with 3 % hydrogen peroxidase solution (Dako, S2023, CA, USA) for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or on a Poroshell 120 EC-C18 (Agilent, 3 x 150 mm, 2.7 µm) reversed phase column ...