Labshake search
Citations for Agilent :
1001 - 1050 of 1135 citations for 6 bromo 2 pyridinemethanamine hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2021Quote: ... Entry clones for other mutant dynamin 2 were prepared by introducing corresponding mutations into the Entry clone of wild type human dynamin 2 using QuikChange Lightning Site-directed Mutagenesis kit (Agilent Technologies, 210518) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... Sizes and yields of RACE products (2 µL aliquots) were determined using a Fragment Analyzer (Advanced Analytics; now Agilent, Santa Clara USA) equipped with 55 cm electrophoresis capillaries and reagents capable of resolving dsDNA fragments between 35 and 1500 bp (see Fig 1E) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the tissue was soaked in 200μl dichloromethane containing 200ng 2-tetradecyl acetate (internal standard) in 2ml glass vials with PTFE-coated caps (Agilent, Santa Clara, USA) for one hour ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were washed with TBST and slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... three washes with phosphate buffered saline (PBS) and the incubation with the primary antibody in the DAKO Real TM antibody diluent (Agilent #S202230-2) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression was performed on 7900 HT fast real time PCR system (Applied Biosystem, USA) using 2× Brilliant III SYBR@ Green qPCR Master Mix (Agilent Technologies, USA) and gene specific primers (Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Genomics 2021Quote: ... After 10 minutes of formalin fixation of the tissue on the slides they were dried with isopropanol and stained with Mayer’s hematoxylin (Dako, cat.no.: S330930-2) and bluing buffer (Dako ...
-
bioRxiv - Microbiology 2022Quote: ... the plates were incubated with serially diluted serum samples for 2 h at room temperature and antibody binding detected using horseradish peroxidase–labelled rabbit anti-guinea pig antibody (Dako, Glostrup, Denmark) and 5,5’-dithiobis-(2-nitrobenzoic acid) ...