Labshake search
Citations for Agilent :
901 - 950 of 1518 citations for 6 CHLORO 3 ETHYL 2 PROPYL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Cancer Biology 2021Quote: ... for which tissues was treated with heated Target Retrieval Solution pH 6.1 (S169984-2, Dako) for 30 min) ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue sections −1.70 mm from Bregma were mounted onto microscope slides (Dako, Cat# K802021-2), allowed to dry upright for 30 min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Labeled DNA was hybridized to a custom ChIP-on-Chip 2×105K microarray (Agilent G4498A), designed with 102,839 60-nucleotide probes tiled across the K ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antigen retrieval was performed by boiling slides immersed in Target Retrieval Solution (DAKO, S169984-2) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Immunology 2021Quote: ... the slides were immersed in an antigen retrieval solution pH 9.0 (Agilent Dako, S236784-2) and kept in a pressure cooker for 2 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent), following the respective manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg amplified cDNA was Cy3-labeled using the SureTag DNA labeling kit (Agilent Technologies). The Cy3-labeled DNA was hybridized overnight to 8×60K 60mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions, Santa Clara, CA), fibronectin (2 μg/ml clone MAB1918 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 ng DNA was transformed into the Validation Reporter (VR) strain (Agilent Technologies #200192; discontinued) to obtain 30-40 million transformants using electroporation ...
-
bioRxiv - Pathology 2021Quote: ... we employed Dako Liquid DAB + Substrate Chromogen System® (cat. K346811-2, Agilent Technologies Inc.), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Samples (2 µL) were injected into a 7890B GC/5977A GC/MSD system (Agilent Technologies) with a DB-Wax capillary column (60 m length ...
-
bioRxiv - Neuroscience 2021Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) is purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Neuroscience 2021Quote: ... CD20 (monoclonal mouse – anti-human CD20 IgG2a, clone L26, cat. no. M075501-2, Agilent Technologies), 1:800 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Immunology 2022Quote: ... 100 mM 2-DG using a 96-well extracellular flux analyzer XFe-96 (Seahorse Bioscience).
-
bioRxiv - Cancer Biology 2022Quote: ... blocked for 1 hr in 2% BSA + 0.1% Tween20 + 1:50 normal goat serum (DAKO) in PBS and washed twice with PBS + 0.5% Tween ...
-
bioRxiv - Neuroscience 2022Quote: ... for 30 min at RT and peroxidase activity was revealed using DAB+ (Dako, K346811-2). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... and by (2) capillary electrophoresis on Fragment Analyzer (Agilent, HS Large Fragment Kit DNF-493). The quality control of gHMW DNA before degradation showed a DNA concentration of 10 ng/µL ...
-
bioRxiv - Neuroscience 2022Quote: ... Endogenous peroxidase was blocked using a ready-to-use peroxidase-blocking solution (S202386-2, Dako). The primary antibody was diluted in antibody diluent (S080983-2 ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were visualized with 3,3′-diaminobenzidine (DAB) (K346811-2, Agilent Technologies, Inc., Santa Clara, CA) or Vina Green (BRR807AS ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were diluted to appropriate working concentration using Antibody Diluent (S302283-2, Agilent Technologies Inc).
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting them in clear mounting medium (DAKO, cat#S3023). We imaged fluorescent signals of mounted brain sections under a scanning microscope (ZEISS ...