Labshake search
Citations for Agilent :
551 - 600 of 1403 citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... for 1 hour RT and replacing the secondary antibody incubation with HRP-labeled polyclonal goat α-mouse antibody (Dako K4000) for 30 minutes RT ...
-
bioRxiv - Genetics 2019Quote: ... Isolated RNA was reverse transcribed into cDNA was by Prime Script TM RT reagent Kit with gDNA Eraser (Stratagene, Takara). Real-time PCR was performed on ABI-7500 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentration was measured by Nanodrop and 1 to 3 μg of RNA was reverse transcribed with AffinityScript Multi-Temp RT (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and retention time (RT) were imported into a personal compound database and library (PCDL Manager, version B.07.00, Agilent Technologies) used in data processing workflow.
-
bioRxiv - Biochemistry 2021Quote: ... AccuScript high-fidelity first-strand cDNA synthesis kit for reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) was procured from Agilent.
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated for 1h at RT with the secondary antibody (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Dako; Polyclonal Goat Anti-Mouse Immunoglobulins/HRP, Dako) prepared in the same blocking solution at a dilution of 1:10.000 ...
-
bioRxiv - Physiology 2022Quote: ... Quenching of endogenous peroxidase was performed by 10 min of incubation with Peroxidase-Blocking Solution at RT (S2023, Dako, Agilent). Non-specific unions were blocked using 5% of goat normal serum (16210064 ...
-
bioRxiv - Physiology 2022Quote: ... Quenching of endogenous peroxidase was performed by 10 min of incubation with Peroxidase-Blocking Solution at RT (S2023, Dako, Agilent). Non-specific unions were blocked using 5% of goat normal serum (16210064 ...
-
bioRxiv - Molecular Biology 2022Quote: ... All RT-qPCRs were performed with THUNDERBIRD Next SYBR qPCR Mix (TOYOBO) and an MX3000P Real-Time qPCR System (Stratagene). The primers used are listed in Supplementary Table 5.
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed three times for 20 min in TBS-T before incubation with horseradish peroxidase (HRP)-labeled secondary antibody in TBS-T at RT for 1 hour: Goat anti-Rabbit HRP (1:10,000, Agilent P0448), Rabbit anti-Goat HRP (1:10,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... For staining of macrophages and platelets the aortic tissue sections were blocked for 1 h at RT with protein blocking solution (#X0909, Dako). After blocking ...
-
bioRxiv - Biochemistry 2024Quote: ... sections were incubated for 30 min at RT with the detection system (Envision+ System HRP Mouse and Rabbit, respectively; Agilent Dako), followed by incubation with diaminobenzidine as chromogen and counterstaining with hematoxylin.
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated 45 min at RT prior to mounting in Dako Fluorescent Mounting Media (Dako France SAS, Les Ulis, France). Cells were visualised using an ApoTome 2 Upright wide-field or a Confocal LSM 880 microscope (Carl Zeiss SAS).
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by double-stranded plasmid mutagenesis using the primer pairs listed in Table S1 and a Quikchange Site-Directed Mutagenesis Kit (Agilent Tech.). After verification by DNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... and amplified with the primers to yield an amplicon roughly 150-250 base pairs in length using Herculase II Fusion Polymerase (Agilent #600675). The PCR protocol involved a 2 minute denaturation at 95C ...
-
bioRxiv - Microbiology 2019Quote: Libraries were checked for small fragments (primer dimers and/or adapter dimers) using a 2100 Bionanalyzer (Agilent, Santa Clara, CA, USA) with the High Sensitivity DNA kit (Agilent) ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Genomics 2021Quote: ... Gene-specific probes were generated by random priming in the presence of ATP [α32P] using the Prime-It II Random Primer Labeling Kit (Agilent, 300385) using PCR generated DNA template produced from gDNA isolated from a wild type S.pombe strain (YP71 ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA was next converted to cDNA by using a polydT primer and following the AffinityScript Multiple Temperature cDNA Synthesis kit instructions (Agilent Technologies). In order to quantify the HEV genome ...
-
bioRxiv - Biophysics 2021Quote: ... and E217A were cloned with primers IF733 and IF734 using QuikChange Lightning Multi Site-Directed Mutagenesis Kit to generate plasmid pIF585 (Agilent #210516). RAD51(K133R ...
-
bioRxiv - Biophysics 2020Quote: ... The desired base pairs coding for Cys were introduced using overlapping primers with the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Immunology 2022Quote: ... A second reverse transcription reaction was performed with MARS-seq RT2 primer and the Affinity Script cDNA Synthesis Kit (Agilent Technologies) followed by 1.5X AMPure XP bead cleanup ...
-
bioRxiv - Biochemistry 2020Quote: ... SDM was carried out with appropriate primers (Table 4) using QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to manufacturer’s instruction.
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was performed with 5 μl of 20x-diluted cDNA and a primer concentration of 1 μM in a 20 μl reaction with Brilliant III Ultra-Fast SYBR GREEN Master Mix (Agilent, www.agilent.com) with a BioRad CFX Connect thermocycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated with site-directed mutagenesis using custom-designed primers (Eurofins Genomics) and PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies). Truncated NALCN ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2023Quote: ... The predicted CLIPA8 cleavage site 63IMLR66 was replaced by IEGR [26] using the CLIPA8mutag primer and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to create plasmid pOET3-CLIPA8Xa-V5-His (Table S3) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutations G to C at positions 445 and 457 were introduced into DCP2 in plasmid pQZ145 (Zeidan et al. 2018) using primers AKV005/AKV006 and the Quick-change Site-Directed mutagenesis kit (Agilent, 200519), generating plasmid pAV008 containing dcp2-E149Q,E153Q ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... To reproduce the A-variant the following primers were used for SDM by site directed mutagenesis using QuickChange II site directed mutagenesis kit (Agilent Technologies, UK) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... one μg of total RNA from LV was used to synthetize cDNAs using oligo(dT) primers and affinity script reverse transcriptase (Agilent technologies France). Real-time quantitative PCR analyses were performed using the Light Cycler LC 1.5 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Developmental Biology 2023Quote: ... one µg of total RNA was used to synthetize cDNAs using oligo(dT) primers and affinity script reverse transcriptase (Agilent technologies France). Real-time quantitative PCR analyses were performed using the Light Cycler LC 1.5 (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR probes were labelled with [α-32P]-dCTP (Hartmann Analytic #SRP-305) using the Prime-it II Random Primer Labelling Kit (Agilent, #EK0031) and purified on illustra Microspin G-50 columns (Cytiva #27533001 ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
bioRxiv - Neuroscience 2021Quote: ... the slides were counterstained with DAPI for 30 sec at RT and mounted using Dako fluorescent mounting medium (Agilent Technologies, USA). The dyes used for signal detection were Opal Dye 520 and Opal Dye 570 (Akoya Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...
-
bioRxiv - Cell Biology 2023Quote: ... Probes (available in Table S7) were labeled with 32P-dCTP using the Prime-It RT random labeling kit (Agilent, catalog #300329) and hybridized to the membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed and incubated with HRP-conjugated secondary antibodies for 1 h at RT (Goat-anti-Rabbit-HRP, Goat-anti-Mouse-HRP, both Dako Denmark). Marker lanes were incubated with Streptavidin-biotinylated-HRP (GE Healthcare) ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2024Quote: ... sections were incubated for 30 min at RT with the detection system (Envision+ System HRP Mouse and Rabbit, respectively; Agilent Dako), followed by incubation with diaminobenzidine as chromogen and counterstaining with hematoxylin.
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed as previously described (Sodi et al., 2015) using Brilliant II qRT-PCR Master Mix 2 Kit (Stratagene, San Diego, CA, USA) using Applied Biosystems 7500 machine. ...
-
bioRxiv - Cell Biology 2019Quote: ... on an Mx3000P real-time PCR machine (Agilent Technologies Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and AriaMx real-time PCR system (Agilent Technologies, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5 ml plastic tubes (PCR tubes, Stratagene, Cedar Creek, TX). Samples were rapidly heated to 37°C directly in cuvettes pre-warmed to 37°C in a Pelltier cell changer (took 30 sec) ...
-
bioRxiv - Genomics 2022Quote: Purified PCR product was measured using a D5000 ScreenTape (Agilent). cDNA samples were diluted to 600 pg/μL and 2 μL of this was used for tagmentation with Nextera XT kit.
-
bioRxiv - Molecular Biology 2021Quote: ... or a Stratagene Mx3005P Real-Time PCR system (Agilent Technologies) with LightCycler® 480 SYBR Green I Master Mix (Roche ...