Labshake search
Citations for Research Products International :
1 - 9 of 9 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... separate PCRs were set up to generate the CITE-seq ADT library (SI-PCR and RPI-x primers) and the HTO library (SI-PCR and D7xx_s).
-
bioRxiv - Molecular Biology 2021Quote: ... and Illumina TruSeq PCR primers (RP-1, common; and RPI-X, indexing) was added to each cDNA and amplification was done according to manufacturer’s suggested 2-step cycling conditions for NGS applications ...
-
bioRxiv - Plant Biology 2022Quote: ... 5.5 µL of sample were added to 21 µL of PCR master mix with Illumina TruSeq Small RNA PCR primer (RP1) and Index Adaptor (RPI “X”) (6.5 µL RNase-free water ...
-
bioRxiv - Immunology 2021Quote: ... a unique plate identifier primer (RPI primers) was added with a shared primer RA1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 pmol of gene-specific primer (Supplementary Table 7) and 10 pmol of a TruSeq RNA PCR index (RPI, Supplementary Table 7) 10 nmol of dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... with 25 pmol of TAIL-seq-fw primer (Supplementary Table 7) and 25 pmol of a TruSeq RNA PCR index (RPI, Supplementary Table 7) in a final volume of 50 μl ...
-
bioRxiv - Microbiology 2022Quote: ... Xen20 was also streaked on a secondary set of plates with Luria broth (LB, RPI) alone or supplemented with either 6 mM myo-inositol ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTag libraries were constructed with custom P5_TSO_hybrid primer50 and custom P7_TruSeq-6bp-Unique-Index_EGFP primer (CAAGCAGAAGACGGCATACGAGAT[6bp-RPI]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGGCATGGACGAGCTGTACAAGT*A*A ...
-
bioRxiv - Genetics 2021Quote: PCR products were run on 1.5 % agarose gel (RPI, Troy, NY), excised and purified with Purelink quick gel extraction and PCR cleaning combo kit (Invitrogen ...