Labshake search
Citations for Origene Technologies :
1 - 50 of 390 citations for c Myc Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-Myc-DDK-P2A-Puro (Origene), pLenti-TRIM9-C-mGFP (Origene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Myc-Flag-RNF114 proteins were purchased from Origene (Origene Technologies Inc., TP309752) or were purified as described previously(Spradlin et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses expressing pLenti-C-Myc-DDK-IRES-Neo (OriGene, empty vector) or vector with encoded WT CDKL5 (NM_001323289.2) ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Microbiology 2021Quote: The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-Directed Mutagenesis Kit (Cat# 200521 ...
-
bioRxiv - Microbiology 2023Quote: ... The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-directed mutagenesis kit ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids (Myc-tagged TSPO (‘TSPO-Myc’; catalogue # RC220107, OriGene) or a pCMV EV control (catalogue # PS100001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pCMV6-AC-Myc-DDK and pCMV6-FUT8-Myc-DDK (Origene) expression plasmids were delivered with Lipofectamine 3000 or FuGene 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Myc-RIP2 and Myc-TRAF6 were obtained from Origene. All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (S142A) was cloned into pLenti-C-Myc-DDK-IRES-Puro Lentiviral Gene Expression Vector (OriGene). HEK293T cells were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Myc-Flag-RNF114 proteins were either purified from HEK292T cells as described above or purchased from Origene (Origene Technologies Inc., TP309752). For in vitro auto-ubiquitination assay ...
-
bioRxiv - Cell Biology 2021Quote: ... the OSTM1-Myc insert from pCMV6-OSTM1-MYC-FLAG (RC209871, Origene) was amplified by PCR using forward primers (OSTM1 ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Microbiology 2022Quote: ... and p62 T269E/S272D-3x Flag were cloned into pLenti-C-Myc-DDK-IRES-Neo vector (Origene) using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro, Origene PS100092) using Lipofectamine 3000 and cultured for 48 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MYC (Origene TP307611) with MAX (Origene TP306812 ...
-
bioRxiv - Genetics 2019Quote: ... Shox2 (Myc-DDK-tagged) and Control (Myc-DDK-tagged) were purchased from Origene. To transduce the ATDC5 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... Myc-DDK-PRRX1a and Myc-DDK-TLR3 were purchased from Origene (RC213276, RC210497). TLR3 was transfected using Lipofectamine™ 3000 and selected with G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Developmental Biology 2022Quote: Lenti-X 293T cells were transiently transfected with a CITED2 (NM_001168388) human c-Myc and DYKDDDDK (DDK) tagged open reading frame clone (RC229801, Origene) using Attractene in DMEM medium supplemented with 100 U/ml penicillin ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... pCMV6-SMARCA5-Myc-DDK (Origene), pLVX-mCherry-N1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... or Myc-NT5C2 (Origene, RC200194) plasmid construct in DMEM:F12 (Sigma ...