Labshake search
Citations for Origene Technologies :
1 - 50 of 142 citations for Yeast Expression Cloning kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene, CAT#: PS100020), KDELR3 transcript variant 2 (NM_016657 ...
-
bioRxiv - Microbiology 2019Quote: The Gpr183 expression plasmid (Origene MR205447) was used as the wildtype control and underwent site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2020Quote: ... KRASG12D expression vector (Origene cat# RC400104) was a kind gift from Dr Karen Mann ...
-
bioRxiv - Immunology 2019Quote: pCMV6-Entry Tagged Cloning Vector was purchased from OriGene (#PS100001).
-
bioRxiv - Neuroscience 2021Quote: ... lentiviral expression plasmid pSKAP2-mGFP (Origene #MR205468L2) was used.
-
bioRxiv - Neuroscience 2023Quote: ... turboGFP mAb (to identify RNAi expression, Origene,), DsRed pAb (to identify mCherry expression ...
-
bioRxiv - Bioengineering 2023Quote: ... CMV-mSmn1 CDS expression cassette (ORIGENE MR203917) was sub-cloned into pAAV-SMN1-HITI.
-
bioRxiv - Plant Biology 2020Quote: The Y2H assay was conducted using the DupLEX-A yeast two-hybrid system (OriGene). The EGY48 yeast strain was transformed with pJG4-5 carrying RK kinase domains or BKNs (prey ...
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of expression clone cDNA (Origene NM_001923) or control cDNA (Origene PS100093 ...
-
bioRxiv - Biochemistry 2023Quote: Lentiviral expression pDCP1b (Origene, Rockville, MD, CAT#: RC207398L1)
-
bioRxiv - Neuroscience 2023Quote: ... Expression vector for GluK2 was purchased from OriGene. All vectors were validated by sequencing (Eurofins Genomics).
-
bioRxiv - Molecular Biology 2021Quote: The vector expressing SOX9-mGFP was constructed by cloning mGFP (PS100040, Origene) with the C-terminal of wild type SOX9 (RC208944 ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Cell Biology 2022Quote: ... Validation of the Y2H result was performed by the DupLEX-ATM yeast two-hybrid system (OriGene). Human Piezo2 CTD was cloned into the pEG202NLS vector and fused with LexA ...
-
bioRxiv - Neuroscience 2022Quote: ... the lacZ-reporter gene assay of the DupLex-A yeast-two-hybrid system (Origene, Rockville, MD) was used ...
-
bioRxiv - Immunology 2022Quote: ... using NKG2D and Ly49A cDNA clone expression vectors (Origene). NKG2D-S/L were generated by PCR using forward 5’ TAGTAGTCTCGAGCCACCATGAGCAAATGCCATAATTACGACCTC 3’ (short isoform ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviral expression plasmids for ZNF416 were purchased from Origene, Inc (Origene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse OSM expression plasmid (MR226014) was purchased from Origene. Mouse STAT3-Y705F plasmid was kindly provided by Prof ...
-
bioRxiv - Cancer Biology 2023Quote: ... or pCMV6□AC□GFP Mammalian Expression Vector (Origene, PS100010) followed by overnight culture on LB agar plates (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... The furin and TMPRSS2 expression constructs were purchased from Origene (Rockville ...
-
bioRxiv - Immunology 2020Quote: ... Digested product was cloned into an expression vector (OriGene pCMV6), sequenced confirmed by Sanger sequencing (Quintara Bio ...
-
bioRxiv - Immunology 2022Quote: The human Myc-NEU3 expression plasmid RC216537 (Origene, Rockville, MD) was used to express NEU3 ...
-
bioRxiv - Biochemistry 2023Quote: ... and for overexpression with lentiviral expression plasmid for DCP1b (OriGene). As a control luciferase shRNA was used ...
-
bioRxiv - Cell Biology 2024Quote: Myc-DDK-tagged ATP6V0A1 expression plasmid (RC226206, Origene, Rockville, MD) for ATP6V0A1 induction and pCMV6-Entry ...
-
bioRxiv - Developmental Biology 2024Quote: ... We used pCMV6-AC-GFP Mammalian Expression Vector (ORIGENE, PS100010) as control vehicle plasmids.
-
bioRxiv - Immunology 2024Quote: ... Both expression vectors were purchased from Origene (OriGene Technologies GmbH).
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Neuroscience 2022Quote: ... were cloned into HuSH shRNA GFP AAV Cloning Vector (pGFP-A-shAAV Vector; TR30034, Origene). The efficiency of the specific Opn3 shRNA was tested in HEK293T/17 cells (human embryonic kidney cell line ...
-
bioRxiv - Biochemistry 2023Quote: ... HTSF1–mNeonGreen was produced by cloning the HTATSF1 from pCMV6-Entry (Origene, Rockville, MD, USA) vector into the pEYFP-N1 vector between AfeI/SalI restriction sites ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2020Quote: ... The human pCMV6-AC-AQP9-GFP expression vector was from Origene. 30% H2O2 solution ...
-
bioRxiv - Biochemistry 2022Quote: ... and METTL7B-pCMV6 expression vectors were sourced from Origene (Rockville, MD); Dulbecco′s Phosphate Buffered Saline ...
-
bioRxiv - Cell Biology 2023Quote: ... were used to transfect pCMV6-Entry Mammalian Expression control (PS100001, Origene) and Human Dlk2 pCMV6 (RC210622 ...
-
bioRxiv - Immunology 2019Quote: ... SCF and TPO were amplified by PCR from cDNA expression plasmids (Origene) and cloned into pMX retroviral vectors (vectors details in Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Microscopy experiments utilized the pCMV6-GCGR-MycDDK expression construct (OriGene Technologies, MR207767). All subsequent experiments used the generated signal sequence Flag-tagged glucagon receptor ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse AP-3μ1 expression plasmid was purchased from Origene (Ref. MR206629) and consists of AP-3μ1-myc-DDK in pCMV6-ENTRY ...
-
bioRxiv - Genetics 2023Quote: ... The Myc-DDK-tagged-CBX1 expression vector was purchased from Origene (RC205672). CBX1 mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs Inc. ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression plasmid for OPA1 was purchased from Origene (#SC128155, Rockville, MD, USA), and HA- TAp73 cloned into the pcDNA3 backbone.
-
bioRxiv - Cancer Biology 2019Quote: ... Control HCT116 cells (WT) were established by transfecting pCMV6-AC-GFP Tagged Cloning Vector (Origene, Cat # PS100010) into HCT116 cells ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Cell Biology 2021Quote: ShRNA for canine synaptopodin cloned into puromycin-selectable pRS mammalian expression vector (Origene) has previously been described (Kannan and Tang ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Biochemistry 2024Quote: ACSS2 expression vector with FLAG tag (NM_018677) was purchased from Origene (Rockville, MD) for mammalian expression ...
-
bioRxiv - Microbiology 2022Quote: ... The hORF3c and bORF3c were cloned in pCMV6-Entry Mammalian Expression Vector (Origene, PS100001) in frame with C-terminus Myc-DDK tag ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with 5ug of FOLR3 expression plasmid with FLAG tag (Origene RC212963) using JetPRIME transfection reagent (Polyplus ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse EDA-A2 (MC208415) and mouse OSM (MR226014) expression plasmids were purchased from Origene. Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...