Labshake search
Citations for Origene Technologies :
1 - 50 of 453 citations for Recombinant Human CD3D Flag and Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Flag-tagged RNF114 was used as bait to precipitate pure recombinant p21 (Origene Technologies Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLAG-tagged human angiogenin plasmid (Cat# RC208874; OriGene; Rockville, MD), GFP-tagged rat RNH1 plasmid (Cat# ORa42809C ...
-
bioRxiv - Genomics 2019Quote: Human myc-FLAG tagged PPP2R3B ORF clone from Origene (RC222908) was linearised and the insert DNA amplified using modified primers generating an N-terminal Myc tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK cells were co-transfected with human flag-tagged PP1R6 (Origene) and His6-tagged VASP (Benz et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Flag-tagged human GPR37L1 was purchased from Origene (Cat No. RC208132). Fabp7-mGpr37-AAV9 or mock AAV9 virus was generated by Vector Builder (Chicago ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: Myc-Flag-tagged SOX9 (PS100016 Origene) and 6x-HIS-tagged-HOXB2 (Addgene 8522 ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Biophysics 2023Quote: ... flag-tagged mTHSD7A construct serving as the PCR template (Origene).
-
bioRxiv - Cell Biology 2023Quote: FLAG-tagged wild type AMOTL2 (NM_016201) was obtained from Origene. Codon-optimized sequences encoding truncated ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Neuroscience 2023Quote: ... The FLAG/Myc-tagged Zbtb7a construct was purchased from Origene (RC222759). The Zbtb7a shRNA (5’-GCCAGGAGAA GCACTTTAAG-3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2021Quote: Myc-flag-tagged full-length Cdh8 was purchased from Origene (plasmid #MR218916). Cdh8 was expressed under the CMV promoter in the pCMV6 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Cancer Biology 2019Quote: WM-46 cells stably transduced with FLAG-tagged KDELR3-001 (ENST00000216014) were transfected with GFP-tagged AMFR construct (Origene, RG209639) using FuGENE® HD transfection reagent as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Microbiology 2020Quote: ... The pCMV6 construct coding for myc-FLAG tagged GNG5 was purchased from OriGene.
-
bioRxiv - Microbiology 2020Quote: Vectors expressing C-terminally FLAG-tagged ATP6V0C and ATP6V0C” were obtained from OriGene Technologies Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Genetics 2020Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
-
bioRxiv - Immunology 2023Quote: ... CDS of IRF8 from IRF8 human tagged ORF clone (RG217646, Origene) were cloned and digested with BamHD1 and XhoI ...
-
bioRxiv - Cancer Biology 2023Quote: ... by replacing luciferase gene with IRF4 Human Tagged ORF (Origene #RC204876). IRF4 tetracycline-inducible cell lines (RL CREBBPWT ...
-
bioRxiv - Neuroscience 2023Quote: TMEM43 Human Tagged ORF Clone (NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Molecular Biology 2022Quote: ... GTPBP3 (NM_001128855) Human Tagged ORF Clone was purchased from Origene (cat # RC225798).