Labshake search
Citations for Origene Technologies :
1 - 50 of 258 citations for Rabbit Anti Salmonid Ig Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-Rab IgG secondary rabbit antibody (OriGene Technologies, U.S.) were diluted at 1:5000 for incubation with the membrane ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-CCR7 polyclonal antibody (TA310252, Origene, Rockville, MD). The secondary antibodies were FITC- ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-C.a polyclonal antibody at 25 µg/mL (OriGene) counterstained with a secondary goat anti-rabbit IgG conjugated with Alexa Fluor 555 at 0.4 µg/mL (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Biochemistry 2022Quote: ... and Rabbit Polyclonal Anti-METTL7A Antibody was obtained from Origene (Rockville, MD). Reagents and materials for cell culture and gene modulation ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Neuroscience 2019Quote: The following antibodies were used: FRMPD2 (rabbit, Sigma;rabbit, Origene), Flag(mouse ...
-
bioRxiv - Genomics 2021Quote: ... the corresponding horseradish peroxidase (HRP)-conjugated Goat anti-Rabbit IgG secondary antibody (Origene, Cat#PV-6002) was sequentially used for incubation at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit anti-MMP9 (OriGene, TA326652), anti-GAPDH (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... the anti-TFAM (TA332462, rabbit; Origene, Rockville, USA) antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Cell Biology 2021Quote: ... respectively): anti-SKAP (1ug/ml, rabbit, Origene, TA333584), anti-α-tubulin (DM1A ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFP rabbit polyclonal (Origene, TA150032, 1:10,000), anti-HA mouse monoclonal (BioLegend ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2021Quote: ... To introduce targeted DSBs in the rDNA IGS gRNA (GATTTCCAGGGACGGCGCCTTGG) was introduced in the pCAS9 vector (OriGene) and transfected in cells ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-GABRA5 (1:200, Origene Cat# TA338505), guinea pig polyclonal anti-GAD2 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Cancer Biology 2019Quote: ... and polyclonal anti-rabbit IgG (1:5000, R1364HRP, OriGene, Germany). Proteins were detected using chemiluminescence HRP substrate (Merck) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Physiology 2023Quote: ... Rabbit polyclonal anti-human C12orf23 (TMEM263) was from Origene (TA333490). Mouse monoclonal JAK2 (C-10) ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...