Labshake search
Citations for Origene Technologies :
1 - 32 of 32 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA was obtained by RT-PCR and amplified through PCR using respective primers (OriGene Technologies) followed by agarose gel electrophoresis to assess the gene expression ...
-
bioRxiv - Immunology 2022Quote: ... Gene-specific PCR primer pairs were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biophysics 2023Quote: ... flag-tagged mTHSD7A construct serving as the PCR template (Origene).
-
bioRxiv - Biochemistry 2023Quote: ... PCR was performed using the human CYP4F2-myc-DDK (OriGene RC216427) plasmid (Forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 CDS was PCR amplified from the TrueORF pCMV-Entry vector (Origene) and cloned via Gibson assembly (NEB ...
-
bioRxiv - Immunology 2019Quote: ... SCF and TPO were amplified by PCR from cDNA expression plasmids (Origene) and cloned into pMX retroviral vectors (vectors details in Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The digested PCR product was ligated into a pCMV6-Entry plasmid (Origene) with T4 DNA ligase ...
-
bioRxiv - Microbiology 2020Quote: ... The murine Sel1L gene was PCR-amplified from pCMV6-Sel1L-Myc-DDK (OriGene) and subcloned in pcDNA3 ...
-
bioRxiv - Neuroscience 2021Quote: ... Bcl6 (NM_009744) was cloned by PCR using a cDNA clone (Cat.No. MC203091, Origene) as template and inserted into CAG-CtlGFP to generate CAG-LSL-Bcl6GFP ...
-
bioRxiv - Microbiology 2021Quote: ... the myc-DDK-tagged-RORC2 cDNA was PCR-amplified from plasmid RC212239 (Origene) and cloned into the MLV-based retroviral vector pMIG Blasti (gift of Jeremy Luban ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Physiology 2021Quote: ... which was obtained by PCR from plasmid pCMV6-EIF2A-GFP (MG209105, OriGene, Rockville, MD) using forward primer 5’-ATTCGTCGACTGGATCCGGT-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length cDNA of TCF7L1 (NM_031283) was PCR-amplified from a commercial plasmid (Origene, SC126274) and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward ...
-
bioRxiv - Cancer Biology 2020Quote: Full-length BAP1 cDNA was amplified by PCR from pCMV6-AC BAP1 plasmid (Origene-SC117256) and cloned into the lentiviral plasmid pCCL-CMV-flT vector ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product and the plasmid pLenti-C-mGFP (# PS100071 OriGene Technologies, Rockville, MD, USA) were digested with Asc1 (#R0558L Bioconcept ...
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Neuroscience 2022Quote: ... The DNA templates were made by PCR amplification from a plasmid pCMV6-mNlgn2(A+)-mycDDK (Origene, catalog #MR222168 ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The canonical RIPK2 coding sequence (NM_003821) and MKK7 (i.e., MAP2K7) coding sequence (NM_145185.4) were amplified by PCR from a RIPK2 vector (Origene, #RG202530) and a MKK7 vector (GenScript ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Microbiology 2021Quote: The open reading frame of human MIF was amplified by PCR from the vector pCMV6-entry MIF (Origene) and cloned into the pET11a vector (Novagen ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Developmental Biology 2021Quote: A synthetic DNA construct encoding mouse ACVR1 with the R206H mutation (G to A at nucleotide position 617) was assembled from synthetic oligonucleotides and PCR products and cloned into the pCMV6 entry mammalian expression vector (Origene), which also encodes a neomycin resistance marker ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
A mean-field approach for modeling the propagation of perturbations in biochemical reaction networksbioRxiv - Pharmacology and Toxicology 2021Quote: ... Chop mRNA levels in treated cells were measured using quantitative RT-PCR as previously described [28] using validated primers (OriGene, Cat # HP207450).
-
bioRxiv - Molecular Biology 2023Quote: ... mouse Irx3 (NM_008393) was amplified by PCR from the donor vector pCMV6-entry-Irx3-myc-DDK (cat. no MR208149, Origene, Rockville, MD, USA) with the following forward 5’-CGATCTAAGTAAGCTTCACCATGTCCTTCCCCCAGCTCG-3’ and reverse 5’-GATCTTGGCAAAGCTTAGACGAGGAGAGAGCTGATAAGACC-3’ primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing the Tantalus domain and SLiM sequence by PCR amplification of the required coding region with insertion into pCMV6-AC-Myc-DDK (Origene, Rockville, MD, USA) using an In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...