Labshake search
Citations for Origene Technologies :
1 - 50 of 496 citations for Mouse Chemokine C X3 C Motif Receptor 1 CX3CR1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... cDNA clones in pCMV6 plasmid for these chemokine receptors were obtained from Origene (Rockville, MD). 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-mGFP (Origene). The reaction mix was filled up to 104 μl with OptiMEM (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Scrambled vector sh-Control (sh-C) was purchased from OriGene (pGFP-C-sh-Lenti, TR30021). Lentiviral packaging constructs PAX2 (12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and C (SR305183, OriGene, Rockville, MD) or non-silencing siRNA (SR30004 ...
-
bioRxiv - Neuroscience 2022Quote: ... pLenti-TDP-43WT-C-mGFP (Origene), and pLenti-TDP-434FL-C-mGFP ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cancer Biology 2019Quote: ... or RELA siRNA (Origene, SR 321602A-C). Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene ...
-
bioRxiv - Cell Biology 2023Quote: ... was pGFP-C-shLenti also from Origene.
-
bioRxiv - Molecular Biology 2021Quote: ... two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C, SCR siRNA Origene SR30004 and POLYPLUS INTERFERIN #409-10 as Transfection reagent).
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-Myc-DDK-P2A-Puro (Origene), pLenti-TRIM9-C-mGFP (Origene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-mGFP-P2A-puro-FGF19 (Origene, RC203750L4), EdTP (dominant negative Tcf4 ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... with the full-length c DNA for CCL2 (OriGene). AAV serotype 5 (AAV5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses expressing pLenti-C-Myc-DDK-IRES-Neo (OriGene, empty vector) or vector with encoded WT CDKL5 (NM_001323289.2) ...
-
bioRxiv - Neuroscience 2022Quote: ... or pLenti-TDP-43ΔNLS/2KQL-C-mGFP (Origene, mutations by GenScript). Cells were seeded onto coverslips in 24-well plates at a density of 25,000 cells/well and incubated for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids pGFP-C-shLenti encoding shCYP27A1(TL313602) were from OriGene (OriGene Technologies GmbH ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Cancer Biology 2019Quote: ... and siRNA C: SR422988C) or scrambled siRNAs (SR30004) were purchased from OriGene. Transfection was performed according to the vendor’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus transduction for mGFP (pLenti-C-mGFP-P2A-Puro - Origene Cat# RC211875L4V), CLU_mGFP (CLU(mGFP-tagged)- human clusterin(CLU ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...