Labshake search
Citations for Origene Technologies :
1 - 50 of 442 citations for Irisin Human Mouse Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were stably transfected with either empty vector (pCMV6) or Sox9 expression vector (Origene). These cells were then utilized for promoter luciferase reporter assays using methods reported in our recent studies (31,61) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293 cells were stably transfected with HA-MOP and GFP-conjugated GIRK2 channel plasmids (OriGene). The cells were then seeded in 96-well plates and allowed to grow at 37°C in 5% CO2 for 48 h ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing rat-specific shTET1 was purchased from Origene (#309902). For targeted DNA de-methylation ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...