Labshake search
Citations for Origene Technologies :
1 - 50 of 370 citations for Human Latent Transforming Growth Factor beta Binding Protein 2 LTBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Myc-DDK tagged human CD2-associated protein (RC210191) was purchased from Origene Technologies ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers targeting beta-Actin (ACTB) (NM_001101) were obtained from Origene (Cat. No. HP204660) and included as the reference gene ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...