Labshake search
Citations for Origene Technologies :
1 - 50 of 298 citations for Human CD120b ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...