Labshake search
Citations for Origene Technologies :
1 - 50 of 206 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... ERN1 (Cat: SR301457A&B, Origene), siRNA Negative Control (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... SLC7A11-shRNA sequence 1 (Origene, Cat. TL309282). Transduced cells were maintained in puromycin and GFP positive cells sorted on a BD FACS Melody cell sorter ...
-
bioRxiv - Cell Biology 2021Quote: ... QPCR primer sequences were obtained from OriGene website ...
-
bioRxiv - Neuroscience 2022Quote: ... Nr4a1 sequences were obtained from Origene (#MR209316), PCR amplified (Phusion DNA polymerase ...
-
bioRxiv - Genomics 2023Quote: ... qPCR primer sequences were provided by OriGene or designed by PrimerQuest™ Tool from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cancer Biology 2019Quote: WM-46 cells stably transduced with FLAG-tagged KDELR3-001 (ENST00000216014) were transfected with GFP-tagged AMFR construct (Origene, RG209639) using FuGENE® HD transfection reagent as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30021). Constructs co-expressed GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30033). Constructs co-expressed RFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a mouse monoclonal antibody OTI5F12 (likely an internal epitope since the full 479 aa sequence was used as an antigen; Origene Technologies, Rockville, MD) were used as capture antibodies for the enrichment of ERG protein from cell lysates (Figure 1B) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sequences for the primers were obtained from Origene and primers were obtained from Metabion ...
-
bioRxiv - Molecular Biology 2020Quote: ... The scrambled gRNA sequence was obtained from pCas-Scramble (Origene). For in vitro assays ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Neuroscience 2023Quote: ... Primer sequences were obtained from Origene (MP208179, MP200232 and MP212857). Primer efficiency was calculated and incorporated in the ΔΔCt method analysis [18].
-
bioRxiv - Pathology 2024Quote: ... The coding sequence for Gremlin-1 (Origene, Cat-No RC210835) was inserted into the plasmid pWPI (kindly provided by Roy Bicknell at University of Birmingham) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for the coding sequence of mouse CCN1 (Origene # MR221828) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... All qPCR primer pair sequences were from OriGene (Rockville, MD).
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequence of the constructs was verified by DNA sequencing (Origene). Scrambled shRNA (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... CLIP-RAMP2 [cloned in-house and sequence-verified from RAMP2 (Origene) and CLIP-β2-AR (a gift from Professor Davide Calebiro ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... pCMV6-XL4-PPARγ (human sequence) was purchased from Origene (Rockville, MD, USA).
-
bioRxiv - Microbiology 2020Quote: ... the ACE2 coding sequence was amplified from an ACE2 cDNA (Origene Inc) using primers with flanking 5’-XbaI and 3’-SalI sites and cloned into pLenti.CMV.GFP.puro ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Biochemistry 2021Quote: METTL5 coding sequence was amplified from pCMV-Entry-METTL5-Myc-DDK (Origene cat# PS100001) by PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutated FUS cDNA sequences were subcloned similarly into the pCMV6-AN-GFP vector (Origene) for expression of N-terminal GFP-tagged FUS protein ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Immunology 2021Quote: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the c17orf80 sequence (NM_001100621) amplified from a commercially available tagged ORF clone (OriGene; RC221916L3) and pDEST-pcDNA5-BirA-FLAG vectors (Couzens et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Cancer Biology 2021Quote: ... construct was designed by Origene based on the sequence( Accession Number:NM_001216 ; Homo sapiens) and cloned into a pCMV6 vector (PS10001, Origene, MD) to form pCMV6/CA-IX vectors (CQ10630 ...