Labshake search
Citations for Origene Technologies :
1 - 50 of 302 citations for Dengue Virus Serotype 3 Envelope Protein Mouse Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Cell Biology 2019Quote: ... protein tag or peptide tag (Myc-DDK; OriGene Technologies). Images of the mCherry-tagged transfected cells were taken 24 hours posttransfection ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-DDK-Flag tag (Origene, 1:2000); rabbit anti-pS/TQ (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse mAb anti-6xHis tag (clone HIS.H8) was from OriGene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Physiology 2023Quote: ... DDK tag (Origene, TA50011-100), Histone 3 (abcam ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Physiology 2023Quote: ... The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912, OriGene). SIK3-Flag-ΔPKA (ΔPKA ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...
-
bioRxiv - Immunology 2020Quote: ... washing with PBST three times, mouse anti-HA-tag lgG2a mAb (4A.Biotech, 4ab000002, Beijing, China 1:1000) or lgG1 mAb (Origene, TA180128, USA, 1:2000) were added into each well (40 μl/well) ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... virus-containing supernatant was collected and concentrated using Lenti-Concentrator (OriGene), for minimum 2h at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were stably transfected with either empty vector (pCMV6) or Sox9 expression vector (Origene). These cells were then utilized for promoter luciferase reporter assays using methods reported in our recent studies (31,61) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293 cells were stably transfected with HA-MOP and GFP-conjugated GIRK2 channel plasmids (OriGene). The cells were then seeded in 96-well plates and allowed to grow at 37°C in 5% CO2 for 48 h ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Neuroscience 2022Quote: ... LILRB5 and OTOR carried out using virus particles obtained from OriGene (Rockville, MD). Virus transduction were carried out at 5.0 MOI using polybrene ...
-
bioRxiv - Cell Biology 2023Quote: ... and TMEM255A followed by Myc-FLAG tag were purchased from Origene (cat ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Biophysics 2023Quote: ... or N1β with an N-terminal tGFP tag (custom plasmid from Origene) by Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ACSS2 expression vector with FLAG tag (NM_018677) was purchased from Origene (Rockville, MD) for mammalian expression ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with 5ug of FOLR3 expression plasmid with FLAG tag (Origene RC212963) using JetPRIME transfection reagent (Polyplus ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-2 (55aa, YP_009137225.1), and B-virus (56aa, NP_851932) were synthesized and cloned in pCMV6-Entry vector by Origene custom service ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Immunology 2021Quote: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)