Labshake search
Citations for Origene Technologies :
1 - 50 of 83 citations for Adenovirus Type 5 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Wild-type HEK293T lysate (Origene LY500001) or HEK293T overexpressing HER2 (Origene LY417979 ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: Wild type and R59W clones (Blue Heron Biotech, OriGene, USA) of ANGPTL8 with Myc-DDK tags were used for transfection using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: FLAG-tagged wild type AMOTL2 (NM_016201) was obtained from Origene. Codon-optimized sequences encoding truncated ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids expressing wild-type or mutated mS37 cDNAs were purchased from OriGene. HEK293 cells (wild-type or mS37 knock-out ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Genetics 2023Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: The human wild-type ARSA cDNA (cloned in the pCMV6 plasmid) was purchased from Origene (Cat. No. RC204319, Origene, USA). The c.925G mutations (c.925G>A ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Immunology 2019Quote: Plasmids of the wild-type mouse Mul1 (pMul1-FLAG) and Asc (pAsc-Myc) were constructed using pCMV6 Mul1-Myc/DDK (MR205346, Origene, Rockville, MD, USA) and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and creatine kinase U-type (CKMT1) cDNA (Origene, Rockville, MD) were cloned into pET-30a vectors (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: Lentiviral Particles were purchased from OriGene Technologies (catalog number TL513177V) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral particles were purchased from Origene (MR204149L2V) containing the mouse KHK-C sequence fused to GFP ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... or control or GCN5L1 ORF lentiviral particles (Origene, USA), followed by puromycin selection ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... LILRB5 and OTOR carried out using virus particles obtained from OriGene (Rockville, MD). Virus transduction were carried out at 5.0 MOI using polybrene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Cancer Biology 2022Quote: ... medium was replaced with 50 μL pre-made lentiviral particles (TNFRSF10B, Origene, Cat. RC201588L4V) in 450 μL complete culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-KO VPAC2KO Panc02 cells were similarly transduced with VPAC2-overexpression lentiviral particles (Origene) at 50 MOI for the rescue experiment ...
-
bioRxiv - Immunology 2020Quote: ... On DAY4 OTII cells were transduced with C1qbp lentiviral particles (Lenti ORF, C1qbp, Origene, NM_007573) versus Lenti-ORF Control Particles at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Cell Biology 2020Quote: ... a gBlock containing the coding sequence for LaNt α31-PAmCherry with EcoR1 and NheI restriction enzyme compatible overhangs (synthesised by Integrated DNA Technologies) was inserted into the pLenti-puromycin vector and packaged in lentiviral particles (produced by Origene). (PS100109 ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral particles containing pLenti-C-PPARG2-mGFP-P2A-Puro or pLenti -mGFP-P2A-Puro were purchased from Origene (Maryland, USA). Titers were provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Immunology 2022Quote: ... then infected with third generation lentiviral particles encoding the BCL6 open reading frame (pLenti-BCL6 ORF-mGFP) or GFP alone (Origene). For knockdown ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);