Labshake search
Citations for Origene Technologies :
1 - 50 of 103 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Bioengineering 2023Quote: ... CMV-mSmn1 CDS expression cassette (ORIGENE MR203917) was sub-cloned into pAAV-SMN1-HITI.
-
bioRxiv - Immunology 2023Quote: Lentiviral Particles were purchased from OriGene Technologies (catalog number TL513177V) ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Molecular Biology 2022Quote: ... with the CMV promoter from pCMV6-Entry (Origene Cat# PS100001). BamHI-HF and NdeI restriction enzymes were used for both plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral particles were purchased from Origene (MR204149L2V) containing the mouse KHK-C sequence fused to GFP ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti-CMV-Itga6-Myc-DDK-P2A-Puro vector was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... or control or GCN5L1 ORF lentiviral particles (Origene, USA), followed by puromycin selection ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Genetics 2022Quote: ... plenti-CMV-HNF1A-cMyc-DDK was used in CUT&RUN experiments (OriGene Technologies RC211201L1). Lentiviruses were produced by transient transfection of HEK293T cells with lentiviral constructs ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... Wild-type HEK293T lysate (Origene LY500001) or HEK293T overexpressing HER2 (Origene LY417979 ...
-
bioRxiv - Systems Biology 2022Quote: ... lentivirus was generated as described above using plenti-CMV-Puro-DEST containing MORC3 (OriGene Technologies, RC210530) or SETDB1 (OriGene Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:100 mouse anti-β-catenin (Origene), 1:100 mouse anti-E-cadherin (Cell Signaling) ...
-
bioRxiv - Pathology 2023Quote: ... and β-actin (1:2000, Origene, TA811000S) was used as loading control ...
-
bioRxiv - Neuroscience 2022Quote: ... LILRB5 and OTOR carried out using virus particles obtained from OriGene (Rockville, MD). Virus transduction were carried out at 5.0 MOI using polybrene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... medium was replaced with 50 μL pre-made lentiviral particles (TNFRSF10B, Origene, Cat. RC201588L4V) in 450 μL complete culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-KO VPAC2KO Panc02 cells were similarly transduced with VPAC2-overexpression lentiviral particles (Origene) at 50 MOI for the rescue experiment ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... and β-actin (mouse; 1:5000; ORIGENE; #TA-09), followed by HRP conjugated secondary antibodies against rabbit or mouse IgG (1:5000 ...
-
bioRxiv - Immunology 2020Quote: ... On DAY4 OTII cells were transduced with C1qbp lentiviral particles (Lenti ORF, C1qbp, Origene, NM_007573) versus Lenti-ORF Control Particles at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: Wild type and R59W clones (Blue Heron Biotech, OriGene, USA) of ANGPTL8 with Myc-DDK tags were used for transfection using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and creatine kinase U-type (CKMT1) cDNA (Origene, Rockville, MD) were cloned into pET-30a vectors (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: FLAG-tagged wild type AMOTL2 (NM_016201) was obtained from Origene. Codon-optimized sequences encoding truncated ...
-
bioRxiv - Cancer Biology 2019Quote: The TDP1 cDNA clone with expression under the control of the CMV promoter in pCMV6-XL4 was obtained from OriGene. H263A substitution was performed using the Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Immunology 2023Quote: A plasmid vector constitutively expressing the Rorc gene under the control of the CMV promoter (pCMV6-Rorc) (Origene, No. MR222309) was co-transfected with a plasmid expressing the luciferase gene (Luc ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids expressing wild-type or mutated mS37 cDNAs were purchased from OriGene. HEK293 cells (wild-type or mS37 knock-out ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were purchased against β-actin (Origene, Rockville, MD, USA, OG-TA811000), CRMP1 (ProSci ...
-
bioRxiv - Cell Biology 2020Quote: ... a gBlock containing the coding sequence for LaNt α31-PAmCherry with EcoR1 and NheI restriction enzyme compatible overhangs (synthesised by Integrated DNA Technologies) was inserted into the pLenti-puromycin vector and packaged in lentiviral particles (produced by Origene). (PS100109 ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral particles containing pLenti-C-PPARG2-mGFP-P2A-Puro or pLenti -mGFP-P2A-Puro were purchased from Origene (Maryland, USA). Titers were provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Immunology 2022Quote: ... then infected with third generation lentiviral particles encoding the BCL6 open reading frame (pLenti-BCL6 ORF-mGFP) or GFP alone (Origene). For knockdown ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...