Labshake search
Citations for Origene Technologies :
1 - 50 of 143 citations for 26S Proteasome Non ATPase Regulatory Subunit 11 PSMD11 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... 70nM non-targeting siRNA (Origene, SR30004) or RELA siRNA (Origene ...
-
bioRxiv - Molecular Biology 2019Quote: ... or non-silencing siRNA (SR30004, OriGene) using Lipofectamine RNAi max (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Neuroscience 2023Quote: ... or vector encoding non-targeting shRNA (shControl; TR30021, OriGene Technologies) were packed in LV by cotransfection with psPAX2 (gift from Didier Trono ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene, CAT#: PS100020), KDELR3 transcript variant 2 (NM_016657 ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... with each well transfected with non-targeting (siCtrl) or YTHDC1-targeted siRNAs (siDC1, Origene # SR314128 ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Neuroscience 2022Quote: ... non-silencing hairpin control (HIV-GFP-shscr) were obtained from Origene (Cat# TL710108 and #TL711639). All expression plasmids (listed in Table S4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi, 0415). The cells were transfected using Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Cancer Biology 2021Quote: We purchased paraffin-embedded sections of prostate specimens from 6 healthy volunteers and 11 patients with prostate cancer (OriGene Technologies). Characteristics of human patients with prostate cancer are summarized in table S3.
-
bioRxiv - Cancer Biology 2019Quote: Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA). PITX1 ΔHD1 ...
-
bioRxiv - Immunology 2021Quote: ... Locus ID 5893) and non-effective Trilencer-27 Flurescent-labeled transfection control siRNA duplex (SR30002) were obtained from Origene Technologies ...
-
bioRxiv - Biochemistry 2022Quote: Lentiviral pGFP-shHKII vector encoding human shRNAHKII (Cat# TL312415) and non-silencing control pGFP-C-shLenti vector (Cat#: TR30023) were purchased from OriGene Technologies Inc (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Neuroscience 2021Quote: ... constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). For lentivirus-mediated expression ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cell Biology 2021Quote: ... Incubation with primary antibodies at 37°C for 1h included goat β-catenin antibody (cat# AB0095) from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fh1 antibody was purchased from Origene (TA500681), Myc antibody from Cell Signaling Technologies (18583S) ...
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used included Ki67 (ORIGENE, TA802544) and cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Molecular Biology 2019Quote: ... The antibodies used include: anti-turboGFP (Origene, cat # TA150041), -PDHA1 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody against Trim39 was from Origene (#TA505761). Rabbit polyclonal antibody against Trim39 was from Proteintech (#12757-1-AP) ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were immunoblotted using antibodies against Psf1 (Origene, TA339351) Psf2 (Novus Biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...