Labshake search
Citations for Origene Technologies :
201 - 250 of 371 citations for Mouse Anti Clostridium Difficile Toxin A Antibody TA5 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... The separated proteins were then subjected to immunoblotting using GST antibody (M20007L; Abmart; 1:5,000 dilution) and His antibody (F013; ORIGENE; 1:5,000 dilution) or MBP antibody (AE016 ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were immunoblotted using antibodies against Psf1 (Origene, TA339351) Psf2 (Novus Biologicals ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Molecular Biology 2021Quote: ... and anti-ACTB (TA811000, Origene) were used for immunoblotting ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-Bcl-xL siRNAs (Origene) was diluted in jetPRIME (Polyplus transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit anti-MMP9 (OriGene, TA326652), anti-GAPDH (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cytokeratin 8 (Origene BP5074), anti-Ki67-FITC (eBioscience 11-5698-90) ...
-
bioRxiv - Physiology 2023Quote: ... anti-Mitodendra2 (TA150090) from OriGene; anti-GAPDH (GTX627408 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-RalB (OTI2C4, Origene, TA505880), anti-ALFA (Nanotag ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Microbiology 2021Quote: ... and immunostained with antibodies against IFIT1 (Origene TA500948, clone OTI3G8), MX1/2 (Santa Cruz sc-47197) ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunohistochemistry was performed using the following antibodies: SETD7 (Origene, TA503322), GFP (Aves Lab ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... and unconjugated anti-GFP (Origene TA150070), anti-mCherry (Novus NBP2-25158) ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Genetics 2021Quote: ... chicken anti-GFAP (1:200, Origene). Secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Nav1.7 (1:500, Origene, TA329033), anti-CCT5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CCT5 (1:1000, Origene, TA308298), and anti-TMED10 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti ABHD17 (1:1000, Origene TA331704), anti ABHD17 (1:1000 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Immunology 2022Quote: ... 30 The anti-NEU3 (TA590228, Origene) was used at 0.5 µg/mL in PBS-BSA/500 mM NaCl/0.1% NP-40 alternative (EMD Millipore ...
-
bioRxiv - Genetics 2022Quote: ... and goat anti-KLF1 (Origene TA305808). The beads were retrieved using a magnetic stand and rinsed with RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... using 6xhistidine Epitope Tag antibodies (Acris, OriGene Technologies, USA, Fig. S3).
-
bioRxiv - Cancer Biology 2024Quote: ... slides were incubated with primary antibodies: CORO1B (1/200, Origene, CF501573) and CASP3 (1/600 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...