Labshake search
Citations for American BioInnovations, :
1 - 50 of 88 citations for RNA Amplification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... PCR amplification instrument (ABI, 2720), enzyme labeling instrument (BioTek ...
-
bioRxiv - Biochemistry 2021Quote: ... q-PCR amplification was performed by ABI 7900HT fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... and amplification performed on Veriti thermal cyclers (ABI) using the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplification was performed with the Applied Biosystems (ABI) BigDye Direct kit PCR master mix or NEB OneTaq standard buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification products were run on an ABI 3100Genetic Analyzer (ABI, USA) and electrophoregrams were generated ...
-
bioRxiv - Developmental Biology 2020Quote: ... with amplification on a GeneAmp 5700 Thermocycler (ABI, Foster City, CA). Expression levels were normalized to internal control gene GAPDH using the delta delta CT method25.
-
bioRxiv - Zoology 2021Quote: ... The amplification programs were set in ABI GeneAmp® 9700 system (ABI, USA) as follows ...
-
bioRxiv - Molecular Biology 2019Quote: STR amplification was performed on the GeneAmp 9700 thermal cycler (Applied Biosystems ((ABI), Carlsbad ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesised using the High Capacity RNA-to-cDNA kit (ABI) according to manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and amplification products were separated and visualized using capillary electrophoresis (ABI 3730xl Genetic Analyzer). We assessed allele sizes relative to an internal size standard (ROX-500 ...
-
bioRxiv - Genetics 2020Quote: To confirm the fidelity of amplification automated DNA Sequencing was performed (ABI – 3130, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription was performed using a highcapacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μL reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ABI). Power SYBR Master Mix (ABI ...
-
bioRxiv - Genetics 2020Quote: ... Reaction amplification was performed by using ABI StepOne Real-Time PCR system (ABI, Vernon, USA). The reaction conditions were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplification products were analysed on an ABI 7900 fast thermal cycler (Applied Biosystems, ABI). β-actin was measured as a control ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit, ABI). The Light Cycler 480 probe master kit (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, ABI 4368814). PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcription was performed using a high-capacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μl reaction ...
-
bioRxiv - Immunology 2019Quote: ... or whole blood (PAXgene Blood RNA Kit) and reverse-transcribed (ABI High Capacity Reverse Transcriptase). The expression of ISGs (IFIT1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg total RNA using the high-capacity reverse transcription kit (ABI) according to the manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg total RNA was reverse transcribed using the cDNA archive kit (Applied Biosystems – ABI, USA) following manufacturer’s instructions and the resulting cDNA was used as a template for Real Time PCR analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... was used for cDNA amplification in a real-time fluorescence quantitative PCR instrument (ABI, New York, NY, USA). Data were normalized to β-actin values ...
-
bioRxiv - Immunology 2021Quote: ... PCR amplification was performed in the presence of SYBR green in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplifications were developed separately for each one and size analyses by capillarity electrophoresis were developed in SECUGEN S.L (ABI PRISM 310 Genetic Analyzer ...
-
bioRxiv - Genetics 2022Quote: ... The F-primer of each microsatellite was labeled with fluorescent dye (6-Fam, Vic, Ned or Pet) and the amplification products were read by ABI 3130xl Fluorescence Reader (Applied Biosystems).
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA was synthesized using 500-1000 ng RNA and the High-capacity cDNA reverse transcription kit (ABI) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... The gene-specific primers of the Pm69 and the housekeeping gene Ubiquitin were used for qRT-PCR amplification performed on a StepOne thermal cycler (ABI, USA) in a volume of 10 μl containing 5 μl of SYBR Green FastMix (Quantabio ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 2 μg RNA in 20 μl reactions using High-Capacity Reverse Transcriptase kit (ABI, Thermo Fisher). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was synthesized by reverse transcription of 400 ng of RNA using the High Capacity cDNA Transcription Kit (ABI) with random primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... A total of 500ng RNA was reverse transcribed to cDNA using the ABI high-capacity cDNA archive kit (ABI # 4322171) as per the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... 1μg total RNA was used to synthesize cDNA using the High Capacity c-DNA Reverse Transcription kit (ABI-P/N 4368814). cDNA was diluted 1 ...
-
bioRxiv - Neuroscience 2019Quote: ... Two micrograms of total RNA from each sample was used for first-strand cDNA synthesis using the Retroscript Kit (Applied Biosystems, ABI). The reverse transcriptase was omitted in the negative control groups for qPCR.
-
Lowering mutant huntingtin by small molecules relieves Huntington’s disease symptoms and progressionbioRxiv - Molecular Biology 2023Quote: ... cDNA was synthesized from 200 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kit (ABI, Thermo Fisher Scientific) and random hexamers ...
-
bioRxiv - Neuroscience 2021Quote: ... we reverse transcribed RNA into cDNA in an RNAse free environment using the RT TaqMan® MicroRNA Reverse Transcription (RT) kit (Applied Biosystems, ABI) with the miRNA-specific commercial primers (ABI ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA quality was assessed by a Bioanalyzer run of an Agilent Eukaryote Total RNA Pico chip while RNA quantity was measured with a Nanodrop One (ABI). About 50 ng total RNA was used for library preparation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA quality was assessed by a Bioanalyzer run of an Agilent Eukaryote Total RNA Pico chip while RNA quantity was measured with a Nanodrop One (ABI). About 1 μg total RNA was used for library preparation ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA levels in plasma were determined by qRT–PCR (ABI Prism 7900HT sequence detection system ...
-
bioRxiv - Cell Biology 2020Quote: ... 600 ng of total RNA was then reversed transcribed to cDNA (ABI HC cDNA synthesis kit ...
-
Decreased calmodulin recruitment triggers PMCA4 dysfunction and pancreatic injury in cystic fibrosisbioRxiv - Cell Biology 2020Quote: ... The isolated RNA was reverse transcribed and amplicons were detected by ABI PRISM 7000 using SyberGreen ...
-
bioRxiv - Microbiology 2023Quote: ... DENV genomic RNA was quantified using a RT-qPCR detection system (ABI) with a thermal profile of 95°C for 3 min ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quant-iT PicoGreen dsDNA Assay Kit (ABI), First Strand cDNA Synthesis Kit (Servicebio) ...
-
bioRxiv - Plant Biology 2021Quote: ... Independently validated RNA-seq expression values were obtained through qRT-PCR (ABI 7500, Applied Biosystems), performed on biological replicates for the same varieties and conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... High capacity cDNA synthesis kit (ABI cat#4368813), TaqMan qPCR primer probe set ABI ...
-
bioRxiv - Molecular Biology 2024Quote: ... ; one Step RT-PCR Kit purchased from ABI ...
-
bioRxiv - Neuroscience 2021Quote: ... we used High-Capacity cDNA Reverse Transcription kit (ABI) with RNAses inhibitors to reversely transcribed RNA into cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... the BigDye Teminator V3.1 Cycle Sequencing Kit (ABI, USA) was used to extract the total DNA of strain D ...
-
bioRxiv - Zoology 2019Quote: ... and Big dye terminator sequencing kit (ABI Prism, USA), and a 614 base pairs length of 5 sequences of cytochrome c oxidase subunit 1 (COI ...
-
bioRxiv - Neuroscience 2020Quote: ... High Capacity cDNA Reverse Transcription Kit (#4368814) was from ABI/Thermo (Waltham ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries were quantified (KAPA Library Quantification Kit (Illumina/ABI Prism), normalized ...