Labshake search
Citations for ChromoTek :
1 - 50 of 61 citations for Beta Actin Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Anti tdTom (ChromoTek™ #5f8 mAb) and anti myc (purified and concentrated from 9E10 hybridoma cell line generously provided by Prof ...
-
bioRxiv - Cell Biology 2019Quote: ... All custom actin nanobody probes were generated starting from the commercial vector of actin chromobody-tagGFP or actin chromobody-tagRFP (ChromoTek) and cloned via the BglII and NotI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent nuclear actin nanobody (nuclear actin chromobody) plasmid was purchased from ChromoTek and transferred into the HindIII-EcoRI site of pGEMHE ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclear actin filaments were visualized with a GFP tagged nuclear actin chromobody (Chromotek) and filaments were induced with 8 µM Ionphore A23187 (Sigma ...
-
bioRxiv - Pathology 2021Quote: ... sections were blocked and antibodies were incubated at 4°C overnight which was either primarily conjugated with Alexa Fluor 488-conjugated dual monoclonal recombinant alpaca anti-rabbit IgG nano secondaries (Chromotek) or detected with the Vectastain Elite ABC-HRP Kit (VectorLaboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary Rat anti-RFP (mAb 5F8 Chromotek, 1:500) and secondary goat anti-rat Cy3 (Jackson 112-165-167 ...
-
bioRxiv - Cell Biology 2022Quote: ... Actin-Chromobody-TagGFP2 (AC-GFP, Chromotek), LifeAct-TagGFP2 (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... recombinant binding protein (gt-250, Chromotek). The secondary antibodies we used were AffiniPure goat anti-mouse IgG (H+L ...
-
bioRxiv - Biophysics 2023Quote: ... The Actin-chromobody (ChromoTek Inc., Hauppauge, NY) containing a C-terminal EmeraldFP–6xHIS tag was cloned into pET22b (Novagen ...
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Cell Biology 2019Quote: ... The mCherry fluorescent signal was enhanced with rat mAb anti-RFP (Chromotek). As secondary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... and actin chromobody GFP (pAC-TagGFP from Chromotek) were obtained by transfection with Fugene HD according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant myc and myc-BDNF were from Chromotek and Cusabio ...
-
bioRxiv - Biophysics 2021Quote: ... Actin was marked using the mammalian expression vector encoding the cytoskeleton marker Actin-VHH fused to either or RFP or GFP2 and commercially sold as Actin-Chromobody® (Chromotek)
-
bioRxiv - Developmental Biology 2021Quote: The AC-TagGFP2 sequence from the Actin-Chromobody plasmid (TagGFP2) (Chromotek) was cloned into the pMTB vector for mRNA generation ...
-
bioRxiv - Biophysics 2023Quote: ... Purified recombinant Enhanced Green Fluorescent Protein (EGFP) was purchased from Chromotek. Bafilomycin A1 was purchased from InvivoGen ...
-
bioRxiv - Plant Biology 2023Quote: ... GFP tagged proteins were detected using an anti-GFP antibody (1:4000; mAb rat 3H9; Chromotek) and a secondary anti-rat antibody (1:15000 ...
-
bioRxiv - Cell Biology 2023Quote: ... The signal of mCherry and GFP was enhanced using a rat mAb anti-RFP (Chromotek, 5f8-100) and a rabbit pAb anti-GFP antibody (BIOZOL/MBL ...
-
bioRxiv - Cell Biology 2019Quote: ... The Cb-EmeraldFP plasmid consists of a sequence encoding actin chromobody (Cb) from Chromotek followed downstream by an in frame sequence encoding EmeraldFP ...
-
bioRxiv - Cell Biology 2024Quote: For the subcloning of the actin chromobody sequence from the pAC-TagRFP plasmid (ChromoTek, Germany) into the pLew100_v5_Hyg plasmid (Wirtz et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant proteins were isolated from the culture medium by incubating anti-GFP nanobody-conjugated agarose (Chromotek). In some experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit anti-GFP antibody (Chromotek) was then added at a 1:5000 dilution concentration ...
-
bioRxiv - Synthetic Biology 2021Quote: ... FITC MEF values were converted to equivalent fluorescent protein concentrations using calibration curves made using recombinant eGFP from ChromoTek GmbH (reference EGFP-250 ...
-
bioRxiv - Immunology 2022Quote: ... and c-Myc–tagged recombinant mouse NEU3 was purified using a Myc-Trap agarose kit (ytak-20; Chromotek, Hauppauge, NY) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... and rabbit anti-GFP (#PABG1, Chromotek), Rat anti-HA (#ROAHAHA ...
-
bioRxiv - Cell Biology 2022Quote: ... and rabbit anti-GFP (PABG1, Chromotek); Species- and/or mouse isotype–specific secondary antibodies from donkey or goat conjugated to Alexa Fluor 488 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP rabbit polyclonal antibody (PABG1, ChromoTek) for mEGFP detection ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-CAP-D2 serum (1:1000) or rabbit anti-GFP conjugated with Alexa488 (1:1000, Chromotek, PABG1). And then with secondary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... or rabbit anti-mCherry (ChromoTek, 1:5,000). Primary antibodies were detected using HRP- conjugated secondary antibodies (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit polyclonal anti-GFP/EGFP PABG1 (Chromotek), anti-calnexin (StressMarq Biosciences ...
-
bioRxiv - Plant Biology 2023Quote: ... polyclonal anti-GFP produced in rabbit (Chromotek), monoclonal anti-RFP produced in mouse (Chromotek) ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit anti-V5 (Chromotek 14440-1-AP), and mouse anti-V5-HRP (Sigma V2260).
-
bioRxiv - Microbiology 2020Quote: ... incubated O/N in primary antibody (Rabbit Pan-ADPr 1:1000, Cell Signaling E6F6A; Rabbit GFP 1:1000, Chromotek PABG1-100 ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells with Tks5αGFP were cultured on HDFC prepared on #1.5 coverglass for 2 days before stained for F-actin (phalloidin-Alexa Fluor-647) and Tks5αGFP (GFP-nanobody, ChromoTek GFP Vhh, # gt-250) using manufacturer recommended procedures ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-GFP (Chromotek; 1:3000 for immunofluorescence), C3G (generous gift from S ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFP (1:1,000; Chromotek; PABG1-100), rabbit anti-NF1A (gift from Dr ...
-
bioRxiv - Plant Biology 2023Quote: ... polyclonal rabbit anti-GFP (1:3,000; pabg1, Chromotek) followed by polyclonal goat anti-mouse IgG-HRP (1:7,500 ...
-
bioRxiv - Plant Biology 2023Quote: ... polyclonal rabbit anti-GFP (1:3,000; pabg1, Chromotek) followed by polyclonal goat anti-mouse IgG-HRP (1:7,500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were probed with rabbit anti-GFP antibody (Chromotek) at 1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... or anti-GFP pAb rabbit polyclonal (Chromotek, 1:1000) and appropriate Alkaline-phosphatase conjugated secondary antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP (rabbit, Chromotek, PABG1-100, 1:1000 for WB), turboGFP (rabbit ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nano-secondary alpaca anti-rabbit IgG (ChromoTek shurbGNHS-1), GST VHH (ChromoTek st-250) ...
-
bioRxiv - Genomics 2023Quote: ... GFP using the rabbit polyclonal antibody padg1 (1:2000, ChromoTek), tubulin using the monoclonal α-alpha tubulin TEU435 (1:10000 or 1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... GFP was detected by rabbit PABG1 primary (Chromotek, 1:5000 dilution) and goat anti-rabbit IgG HRP secondary (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies used for immunoblotting included rabbit anti-GFP (Chromotek), rabbit anti-VPS39 (PA5-21104 ...
-
bioRxiv - Plant Biology 2023Quote: ... rabbit anti-GFP (1:1000) and mouse anti-RFP (1:2000) (ChromoTek) monoclonal primary antibodies were used in combination with anti-rabbit or anti-mouse IgG horseradish peroxidase conjugated secondary antibodies ...
-
bioRxiv - Plant Biology 2024Quote: ... The primary antibodies used included polyclonal anti-GFP produced in rabbit (Chromotek), polyclonal anti-PR1 produced in rabbit (Agrisera) ...
-
bioRxiv - Plant Biology 2020Quote: ... Polyclonal anti-GFP and anti-BFP (tRFP) antibody produced in rabbit (Chromotek, UK), monoclonal antibody anti-RFP produced in mouse and monoclonal antibodies anti-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies used for PLA include rabbit anti-GFP (1:200; ChromoTek # PABG1-20, RRID:AB_2749857)) and mouse α-Spectrin (1:50 ...
-
bioRxiv - Plant Biology 2023Quote: ... with a secondary goat-anti-rabbit IgG-HPR at a dilution of 1:3000 (ChromoTek [7C9] and [SA00001-2] ...