Labshake search
Citations for Invivogen :
1 - 50 of 1089 citations for Stem Cell Culture Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: All source cell culture was maintained in media containing plasmocin (1:5000 dilution, Invivogen) to prevent mycoplasma contamination ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Microbiology 2023Quote: ... followed by continued maintenance in cell culture media supplemented with 10µg/mL Blasticidin (InvivoGen).
-
bioRxiv - Immunology 2021Quote: ... SEAP amounts were then measured in the cell culture supernatants using Quanti-Blue Detection Media (InvivoGen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 20μL of cell culture supernatant were added to 180 μL of Quanti-Blue detection media (Invivogen) and developed in the tissue culture incubator for 20 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultures were maintained in media containing 50% WRN conditioned media supplemented with 1mg/mL primocin (InvivoGen), 1mM N-Acetylcysteine ...
-
bioRxiv - Immunology 2022Quote: ... Then 20µL of the culture media was added to QUANTI- Blue substrate (InvivoGen) for 1.5hr and absorbance was measured at 620nm (bio-tek ...
-
bioRxiv - Cell Biology 2022Quote: ... 1x pen/strep (complete explant culture media) and 1x Normocin (InvivoGen, # Ant-nr-1) for 12-14 days in T-75 culture flasks ...
-
bioRxiv - Cancer Biology 2022Quote: ... All culture media were supplemented with Plasmocin (2.5 µg mL−1; InvivoGen, San Diego, CA, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell media included Plasmocin (Invivogen ant-mpt) to prevent mycoplasma growth and antibiotics/antimycotics to prevent bacterial and fungal contamination ...
-
bioRxiv - Cell Biology 2019Quote: ... all cell cultures are treated with plasmocin (InvivoGen) at 500 µg/ml for the initial three passages (6-9 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell cultures were additionally supplemented with Plasmocin (InvivoGen). Cell stocks were generally passaged fewer than 5 times ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Antibiotics used in cell culture include Blasticidin (Invivogen), Geneticin (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell cultures were certified mycoplasma-free (PlasmoTest kit, Invivogen).
-
bioRxiv - Cancer Biology 2022Quote: ... Cells transduced were selected in culture containing puromycin (InvivoGen) or blasticidin (Gibco).
-
bioRxiv - Cell Biology 2021Quote: ... 10 uL of conditioned media from the co-culture wells were mixed with 50 uL of the commercial Quanti-Luc reagent (Invivogen) in a black ...
-
bioRxiv - Immunology 2020Quote: ... we applied cell culture supernatant to QUANTI-Blue medium (Invivogen) and measured alkaline phosphatase activity at 620 nm after 30 min.
-
bioRxiv - Immunology 2024Quote: ... cell culture supernatants were applied to QUANTI-Blue medium (Invivogen) and measured for alkaline phosphatase activity at 620 nm after 90 mins ...
-
bioRxiv - Systems Biology 2023Quote: ... Transfected cells were incubated for 24 hours before transfection media was replaced with media containing 10 ug/ml blasticidin (Invivogen). Cells were incubated for 30 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell culture supernatants were then added to RAW-Lucia™ ISG-KO-STING Cells (Invivogen). Twelve hours after incubation ...
-
bioRxiv - Cell Biology 2021Quote: ... Positive cells were selected with media containing 1.5 mg/mL hygromycin (InvivoGen) and 150 µg/mL blasticidin (InvivoGen ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293FT cells were maintained in G418-containing media (500 μg/mL; Invivogen). Experiments involving doxycycline-inducible ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: PLpro inhibitor antiviral activities were tested in a cell culture assay with A549:hACE2 cells (Invivogen) by the following protocol ...
-
bioRxiv - Genomics 2020Quote: ... fresh mESC media was added to the cells with 10μg/ml blasticidin (InvivoGen) and 1μg/ml puromycin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were selected with media supplemented with puromycin (InvivoGen, cat# ant-pr-1) for a few days and single colonies were selected.
-
bioRxiv - Systems Biology 2023Quote: ... cells were placed under selection with media containing 10 ug/ml Blasticidin (Invivogen). After 2 cell passages in selection media ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Cell Biology 2022Quote: Cell cultures were checked for the absence of mycoplasma (Plasmotest, Invivogen, Toulouse, France).
-
bioRxiv - Immunology 2021Quote: ... cells were incubated at 1×106 cells/mL T cell media plus 1 μg/mL phorbol myristate acetate (PMA) (Invivogen; tlrl-pma), 1μg/mL ionomycin (Calbiochem ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were seeded in a 96 well dish at 1.4×105 cells/mL (HEK-hTLR4) and 2.8×105 cells/mL (HEK-null2) in HEK detection media (Cat# hb-det3 Invivogen) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... detached with a cell scraper and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...
-
bioRxiv - Microbiology 2022Quote: ... growth media were replaced with HEK-blue detection media (Invivogen hb-det2) for SEAP assessment ...
-
bioRxiv - Immunology 2021Quote: ... transduced cells were selected and maintained in culture with 200 μg/mL hygromycin (Invivogen). STING expression was verified by western blotting.
-
bioRxiv - Cancer Biology 2020Quote: ... media containing primocin (InVivoGen). For xenograft implantation ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The K562 cell line was cultured in the same media than NK cells supplemented with 5 µg/mL of Plasmocin (InvivoGen) and was routinely tested for mycoplasma infection with Venor GeM Classic detection kit (Minerva Biolabs).
-
bioRxiv - Synthetic Biology 2022Quote: ... The following day media was exchanged with media containing 0.15mg/mL ganciclovir (InvivoGen). Magnet stimulated cells were then placed under constant magnetic stimulation for 72 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... efficiently-infected cells were selected in cultures containing either puromycin (InvivoGen, 1 ∼ 1.5 µg/ml) or blasticidin (InvivoGen ...
-
bioRxiv - Microbiology 2021Quote: ... and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTer-β-cat cell media was supplemented with 100 µg/ml Zeocin (InvivoGen, ant-zn-05) to select for the β-catenin RNAi cassette.
-
bioRxiv - Microbiology 2021Quote: ... The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen; ant-bl-1) for two weeks ...
-
bioRxiv - Microbiology 2022Quote: ... 180 µl/well of cells at a concentration of 2.8 × 105 cells/ml in HEK-Blue detection media (Invivogen; catalog #hb-det2) were plated in 96 well tissue-culture plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ultrapure LPS for cell culture experiments (Lipopolysaccharide from Escherichia coli 0111:B4) was purchased from Invivogen. NOX2 inhibitor GSK2795039 was obtained from MedChem Express (Monmouth Junction ...
-
bioRxiv - Immunology 2021Quote: ... The medium was changed to cell culture medium containing 1 μg/ml zymosan (InvivoGen Europe, France), 10 ng/ml FSL1 (InvivoGen) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were selected in culture medium supplemented with 3 µg/ml puromycin (Invivogen, ant-pr-1), and selection was completed for 48 h before cells were harvested ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged and resuspended in media with puromycin (0.6 μg/mL) (InvivoGen, San Diego, California, U.S.A). Cells were maintained with these conditions several days ...
-
bioRxiv - Biochemistry 2022Quote: ... and stably integrated cells were selected and maintained in media containing either zeocin (100 μg/mL; Invivogen), puromycin (500 ng/mL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were trypsinized and re-plated in media containing 100 µg/mL hygromycin (InVivogen, ant-hg-1) to begin selection ...
-
bioRxiv - Immunology 2023Quote: ... and PRR expression was maintained by growing the cells in media containing Blasticidin (ant-bl-05, InvivoGen), Zeocin (ant-zn-05 ...