Labshake search
Citations for Invivogen :
1 - 50 of 73 citations for Rat TUT1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of three to five control shRNAs (Invivogen) and a blasticidin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
bioRxiv - Developmental Biology 2021Quote: shRNAs were designed based on (He et al., 2018) and using the siRNA Wizard from Invivogen (available at https://www.invivogen.com/sirnawizard/design_advanced.php) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Molecular Biology 2022Quote: ... the FTO-targeting and Control shRNAs were designed in silico with Blastn (NCBI) and siRNA wizard (Invivogen) online tools ...
-
bioRxiv - Neuroscience 2020Quote: ... because we were not able to identify a specific shRNA target sequence using web-based design tools (InvivoGen siRNA Wizard ...
-
bioRxiv - Immunology 2022Quote: ... normal rat PAb IgG control blocking antibodies (InvivoGen), Dexamethasone (10µM ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat Anti-Dectin-1 (1/200, InvivoGen mabg-mdect); Mouse Anti-6E10 (1/500 ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid and Poly I:C (InvivoGen) transfections were done using Lipofectamine-2000 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... IgG4 using IgG plasmids (Invivogen) by conventional cloning techniques as previously described (35 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid pUNO1-hCIITA (InVivogen, Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Biophysics 2022Quote: ... combined with pFUSE-based plasmids (InvivoGen) encoding both heavy (HC ...
-
bioRxiv - Immunology 2023Quote: ... and ligated into pUNO1 plasmid (Invivogen) using T4 DNA ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: The pFUSE-CHIg-mG2a plasmid (InvivoGen) containing the 602 heavy chain variable region was used for the generation of Fc variant antibodies ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids or poly(I:C) (Invivogen, tlrl-pic) were transfected using either Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Wako Chemicals) and rat anti-mouse Clec7a (activated microglia; 1:50; InvivoGen, CA, USA) in 2% NDS and PBS-T for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: A plasmid encoding full-length gp130 (WTgp130; InVivoGen) was used to create the 5 mutants ...
-
bioRxiv - Microbiology 2022Quote: ... pVitro2-neo-mcs plasmid (InvivoGen, San Diego, USA) and S52/SG-Feo(AI ...
-
bioRxiv - Immunology 2023Quote: ... or the mouse kappa light chain plasmid (InVivoGen). The gBlock DNA and plasmids were cut with the specified enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat neutralizing monoclonal anti-mDECTIN-1-IgG (clone R1-4E4) (Invivogen mabg-mdect, 1:30); Rat monoclonal anti-CD206 (clone MR5D3 ...
-
bioRxiv - Immunology 2022Quote: ... were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen). Recombinant protein was produced by transient transfection of Expi293 cells and purified using HiTrap Protein A column ...
-
bioRxiv - Microbiology 2022Quote: ... and then cloned in the pTRIOZ-hIgG1 plasmid (InvivoGen) using the restriction enzymes SgrAI (NEB ...
-
bioRxiv - Immunology 2021Quote: Antibody variable regions were cloned into expression plasmids from Invivogen (#pfusess-hchg1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14). Wild-type human NIK and the NIK-K429/430A mutant plasmids were a gift from Prof ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with the pNifty-SEAP reporter plasmid (Invivogen, #pnifty2-seap), containing NFκB transcription factor binding sites and a secreted alkaline phosphatase (SEAP ...
-
bioRxiv - Immunology 2023Quote: HBEC-3KT cells were transfected with pSELECT-hASC-GFP plasmid (InvivoGen) using linear 25 kDa polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2021Quote: ... Human cGAS (hcGAS) and murine cGAS (mcGAS) plasmids were purchased from Invivogen. Flag-cGAS and V5-cGAS were amplified by PCR and were cloned into pcDNA3.2-DEST plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... complexed with a combination of plasmids pUNO1-hSTING-R232 (Invivogen puno1-hStingWT), pUNO1-hcGAS-HA3X (Invivogen pUNO1-HA-hcGAS) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated 24 hours post plasmid transfection with poly I:C (Invivogen), concentrations stated in figures (final 250μl volume per well) ...
-
bioRxiv - Immunology 2020Quote: ... transfection was performed with 20 ng of the STING plasmid constructs (InvivoGen; San Diego ...
-
bioRxiv - Microbiology 2021Quote: ... for plasmid DNA (pcDNA6 empty vector) or 5’triphosphate dsRNA (InvivoGen tlrl-3prna).
-
bioRxiv - Genetics 2020Quote: ... namely mEF1 and rEF1 promoters from the pVItro1-msc plasmid (InvivoGen #pvitro1-mcs) and the addition of an attP docking site recognition sequence ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid expressing dominant negative TRIF (dnTRIF) was purchased from Invivogen (San Diego, CA). Transfections were performed by electroporation using BTX ECM 630 (Holliston ...
-
bioRxiv - Immunology 2019Quote: ... into expression plasmids adapted from the pFUSE-rIgG-Fc and pFUSE2-CLIg-rK2 vectors (Invivogen). Human and rabbit Abs were transiently expressed with the FreeStyle 293 Expression System (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... The 279bp human AldA enhancer was PCR amplified from the pDRIVE5-GFP-10 plasmid (Invivogen). The HCMV enhancer was PCR amplified from the pDrive5 GFP-1 Promoter Test (Invivogen) ...
-
bioRxiv - Immunology 2023Quote: ... and colonies screened with Zeocin for the heavy and light chain plasmids using Blasticidin (InVivoGen). The plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... we administered plasmid DNA adjuvanted with 20 μg/mouse monophosphoryl lipid A from Salmonella minnesota (Invivogen) via the i.m ...
-
bioRxiv - Cancer Biology 2022Quote: ... The heavy chain of the IgG was cloned from the Fab plasmid into a pFUSE (InvivoGen) vector with a human IgG1 Fc domain ...
-
bioRxiv - Cancer Biology 2022Quote: ... The light chain of the BiTE was cloned from the Fab plasmid into a pFUSE (InvivoGen) vector with an anti-CD3 scFv (OKT3) ...
-
bioRxiv - Immunology 2020Quote: ... We used pNiFty2-IFNB-SEAP and pNiFty2-56K-SEAP promoter-reporter plasmids (InvivoGen; San Diego, CA), encoding the INFβ minimal promoter and the ISG-56K promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transiently transfected with an NF-κB containing reporter construct plasmid (pNifty-Luc™, InvivoGen).
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Molecular Biology 2023Quote: ... partial mouse Azin1 expression plasmids were transfected using Lipofectamine 2000 in the presence of NATETM (InvivoGen) in some experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... pUNO1-hSTING-HA3x (STING-HA) and pUNO1-hSTING-MRP (STING-DN) expression plasmids were purchased from Invivogen. STING-MRP (MITA-related protein ...
-
bioRxiv - Biophysics 2019Quote: The coding sequences of antibody Fc heterodimerization domains were amplified from the pFUSE-hIgG1-Fc1 plasmid (Invivogen) containing two charged mutations on each opposing domain57,58 ...
-
bioRxiv - Immunology 2021Quote: ... variable genes were inserted into plasmids encoding the constant region for the heavy chain (pFUSEss-CHIg-hG1, Invivogen) and light chain (pFUSE2ss-CLIg-hl2 ...
-
bioRxiv - Cell Biology 2020Quote: Rescue experiments were performed by transfecting clonal B16F1 CRTC3 KO cells with pSelect-puro-mcs plasmid (psetp_mcs, Invivogen) carrying full length CRTC3 ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...