Labshake search
Citations for Invivogen :
1 - 50 of 105 citations for Mouse ZNF583 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... or the mouse kappa light chain plasmid (InVivoGen). The gBlock DNA and plasmids were cut with the specified enzymes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14). Wild-type human NIK and the NIK-K429/430A mutant plasmids were a gift from Prof ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of three to five control shRNAs (Invivogen) and a blasticidin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
bioRxiv - Immunology 2019Quote: ... we administered plasmid DNA adjuvanted with 20 μg/mouse monophosphoryl lipid A from Salmonella minnesota (Invivogen) via the i.m ...
-
bioRxiv - Molecular Biology 2023Quote: ... partial mouse Azin1 expression plasmids were transfected using Lipofectamine 2000 in the presence of NATETM (InvivoGen) in some experiments.
-
bioRxiv - Developmental Biology 2021Quote: shRNAs were designed based on (He et al., 2018) and using the siRNA Wizard from Invivogen (available at https://www.invivogen.com/sirnawizard/design_advanced.php) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... the FTO-targeting and Control shRNAs were designed in silico with Blastn (NCBI) and siRNA wizard (Invivogen) online tools ...
-
bioRxiv - Neuroscience 2020Quote: ... because we were not able to identify a specific shRNA target sequence using web-based design tools (InvivoGen siRNA Wizard ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid and Poly I:C (InvivoGen) transfections were done using Lipofectamine-2000 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... IgG4 using IgG plasmids (Invivogen) by conventional cloning techniques as previously described (35 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid pUNO1-hCIITA (InVivogen, Inc. ...
-
bioRxiv - Biophysics 2022Quote: ... combined with pFUSE-based plasmids (InvivoGen) encoding both heavy (HC ...
-
bioRxiv - Immunology 2023Quote: ... and ligated into pUNO1 plasmid (Invivogen) using T4 DNA ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: The pFUSE-CHIg-mG2a plasmid (InvivoGen) containing the 602 heavy chain variable region was used for the generation of Fc variant antibodies ...
-
bioRxiv - Immunology 2022Quote: ... mouse TLR2 neutralizing antibody monoclonal mouse IgG2a (C9A12) and control isotypes mouse IgG2a were from InvivoGen. Mouse TLR4/MD2 complex neutralizing antibody monoclonal rat IgGk clone MTS510 and control isotypes rat IgGk were from eBioscience™ Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids or poly(I:C) (Invivogen, tlrl-pic) were transfected using either Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: A plasmid encoding full-length gp130 (WTgp130; InVivoGen) was used to create the 5 mutants ...
-
bioRxiv - Microbiology 2022Quote: ... pVitro2-neo-mcs plasmid (InvivoGen, San Diego, USA) and S52/SG-Feo(AI ...
-
bioRxiv - Immunology 2022Quote: ... were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen). Recombinant protein was produced by transient transfection of Expi293 cells and purified using HiTrap Protein A column ...
-
bioRxiv - Microbiology 2022Quote: ... and then cloned in the pTRIOZ-hIgG1 plasmid (InvivoGen) using the restriction enzymes SgrAI (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Pam3CSK4 (100 µg/mouse; InvivoGen), or Poly(I:C ...
-
bioRxiv - Immunology 2021Quote: Antibody variable regions were cloned into expression plasmids from Invivogen (#pfusess-hchg1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with the pNifty-SEAP reporter plasmid (Invivogen, #pnifty2-seap), containing NFκB transcription factor binding sites and a secreted alkaline phosphatase (SEAP ...
-
bioRxiv - Immunology 2023Quote: HBEC-3KT cells were transfected with pSELECT-hASC-GFP plasmid (InvivoGen) using linear 25 kDa polyethylenimine (PEI ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Microbiology 2020Quote: ... with 50 μl/mouse of AddaVax (Invivogen) as the adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... or Poly(I:C) (100 µg/mouse; InvivoGen) in 200 µl PBS for 24 h ...
-
bioRxiv - Microbiology 2021Quote: ... Human cGAS (hcGAS) and murine cGAS (mcGAS) plasmids were purchased from Invivogen. Flag-cGAS and V5-cGAS were amplified by PCR and were cloned into pcDNA3.2-DEST plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... complexed with a combination of plasmids pUNO1-hSTING-R232 (Invivogen puno1-hStingWT), pUNO1-hcGAS-HA3X (Invivogen pUNO1-HA-hcGAS) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated 24 hours post plasmid transfection with poly I:C (Invivogen), concentrations stated in figures (final 250μl volume per well) ...
-
bioRxiv - Immunology 2020Quote: ... transfection was performed with 20 ng of the STING plasmid constructs (InvivoGen; San Diego ...
-
bioRxiv - Microbiology 2021Quote: ... for plasmid DNA (pcDNA6 empty vector) or 5’triphosphate dsRNA (InvivoGen tlrl-3prna).
-
bioRxiv - Genetics 2020Quote: ... namely mEF1 and rEF1 promoters from the pVItro1-msc plasmid (InvivoGen #pvitro1-mcs) and the addition of an attP docking site recognition sequence ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid expressing dominant negative TRIF (dnTRIF) was purchased from Invivogen (San Diego, CA). Transfections were performed by electroporation using BTX ECM 630 (Holliston ...
-
bioRxiv - Immunology 2020Quote: The VRC01 LC-P2A-HC construct was PCR-amplified from engineered C57BL/6J mouse cDNA and cloned between the promoter and constant regions of a mouse IgG2b heavy chain expression vector (InvivoGen, #pfuse-mchg2b) using Gibson Assembly ...
-
bioRxiv - Immunology 2019Quote: ... a Mouse TLR Agonist kit was purchased from Invivogen and BMDMs were treated with each ligand for 16 hours ...
-
bioRxiv - Immunology 2019Quote: ... into expression plasmids adapted from the pFUSE-rIgG-Fc and pFUSE2-CLIg-rK2 vectors (Invivogen). Human and rabbit Abs were transiently expressed with the FreeStyle 293 Expression System (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... The 279bp human AldA enhancer was PCR amplified from the pDRIVE5-GFP-10 plasmid (Invivogen). The HCMV enhancer was PCR amplified from the pDrive5 GFP-1 Promoter Test (Invivogen) ...
-
bioRxiv - Immunology 2023Quote: ... and colonies screened with Zeocin for the heavy and light chain plasmids using Blasticidin (InVivoGen). The plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... ASC-expressing RAW264.7 mouse macrophages (RAW-ASC; InvivoGen raw-asc) are engineered to stably express murine ASC ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies used: Mouse anti-HA antibody (InvivoGen, 1:1000), rabbit anti-ACP (1:2000) ...
-
bioRxiv - Immunology 2021Quote: ... Mouse IFN-α was measured by a bioluminescence kit (InvivoGen). All assays were performed on cell free supernatants according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... or 200 µg of isotype control antibody (mouse IgG2a, Invivogen) three times at days 6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse STING activator DMAXX and cGAMP were purchased from InvivoGen.
-
bioRxiv - Immunology 2023Quote: ... mice were immunised with VacOva (vac-pova, InvivoGen; 50μg/mouse) and LPS (L6529 Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... The heavy chain of the IgG was cloned from the Fab plasmid into a pFUSE (InvivoGen) vector with a human IgG1 Fc domain ...