Labshake search
Citations for Invivogen :
1 - 50 of 974 citations for Mouse IgG2b Isotype Control Antibody Biotin A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... or 200 µg of isotype control antibody (mouse IgG2a, Invivogen) three times at days 6 ...
-
bioRxiv - Immunology 2022Quote: ... mouse TLR2 neutralizing antibody monoclonal mouse IgG2a (C9A12) and control isotypes mouse IgG2a were from InvivoGen. Mouse TLR4/MD2 complex neutralizing antibody monoclonal rat IgGk clone MTS510 and control isotypes rat IgGk were from eBioscience™ Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... and isotype control (bgal-mab12, InvivoGen) were added at the time of stimulation ...
-
bioRxiv - Physiology 2021Quote: ... Neutralizing mouse anti-human IL-1α and human IL-1β monoclonal IgG1 antibodies and mouse IgG1 isotype control (mabg-hil1a, mabg-hil1b, mabg1-ctrlm) were purchased from InvivoGen and used at the indicated concentration with a 2 h pre-incubation in CM+ prior to addition to FAPs ...
-
bioRxiv - Microbiology 2020Quote: ... or corresponding isotype controls (10μg/ml, Invivogen), or different concentrations of R406 (Invivogen) ...
-
bioRxiv - Immunology 2020Quote: The VRC01 LC-P2A-HC construct was PCR-amplified from engineered C57BL/6J mouse cDNA and cloned between the promoter and constant regions of a mouse IgG2b heavy chain expression vector (InvivoGen, #pfuse-mchg2b) using Gibson Assembly ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies used: Mouse anti-HA antibody (InvivoGen, 1:1000), rabbit anti-ACP (1:2000) ...
-
bioRxiv - Bioengineering 2022Quote: Non-glycosylated monoclonal human IgG1 antibody against human EGFR (hegfr-mab12, lot: EG12-39-01) and isotype control -Human IgG1 (bgal-mab1, lot: BG1-41-01) were purchased from InvivoGen. Human EGFR (Research Grade Cetuximab Biosimilar ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 ng/mL LPS-EB Biotin (Invivogen), and 0.1 ...
-
bioRxiv - Immunology 2022Quote: ... normal rat PAb IgG control blocking antibodies (InvivoGen), Dexamethasone (10µM ...
-
bioRxiv - Immunology 2023Quote: ... Control antibodies for RBD (InvivoGen, Cat No. srbd-mab12) and N (AcroBiosystems ...
-
bioRxiv - Immunology 2023Quote: ... positive control antibodies for RBD (InvivoGen, Cat No. srbd-mab6) and N (GenScript ...
-
bioRxiv - Immunology 2021Quote: ... anti-TLR2-IgA and IgA control antibody were purchased from Invivogen. Anti-TLR5-Fc mouse was purchased from R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... or the same amount of IgG negative control antibody (Bio-Rad, MCA6004GA for MARCO and Invivogen, bgal- mab10-1 for TLR2) was administered in the same needle with IL-33.
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... or biotin-poly (I:C) (InvivoGen) for 3 h at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... The ds-ppp-RNA positive control (1 µg/mL, (InvivoGen), ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Then ds-ppp-RNA positive control (1 µg/mL, InvivoGen) or ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Immunology 2022Quote: ... THP-1 Dual Control and cGAS−/− cells were obtained from Invivogen. THP-1 IFIT1 cells were maintained in RPMI (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... THP-1 Dual Control and cGAS-/- cells were obtained from Invivogen. Lopinavir (LPV) ...
-
bioRxiv - Microbiology 2023Quote: ... THP-1 Dual Control and cGAS-/- cells were obtained from Invivogen. Nevirapine and raltegravir were obtained from AIDS reagents ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or HMW poly(I:C)-biotin (Invivogen) in the final concentration of 30 ng/ml and ATP (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... and treated with ds-ppp-RNA positive control (1 µg/mL, (InvivoGen), ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Biotin-LPS and PAM3CSK4 were from Invivogen; Soluble mouse uPAR was from CinoBiologicals ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µg/ml Tri-Lys (negative control for NOD1/NULL1) or 10 µg/ml MDP-control (MDP-c; negative control for NOD2/NULL2) (InvivoGen) were used as treatment controls ...
-
bioRxiv - Cancer Biology 2024Quote: ... A positive control of 2 µg/ml of Puromycin (InVivoGen, ant-pr-1) was included ...
-
bioRxiv - Cell Biology 2022Quote: ... and mixtures of biotin-LPS (Invivogen, tlrl-lpsbiot) and streptavidin (Neuromics ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... or control agonist (Invivogen #tlrl-3prnac) were transfected with LyoVec™ (Invivogen #lyec-12 ...
-
bioRxiv - Bioengineering 2023Quote: ... ds-ppp-RNA positive control (InvivoGen), ss-ppp-miRNA-21 (8 µg/mL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or control agonist (Invivogen #tlrl-3prnac) were transfected with a cationic lipid-based transfection reagent -LyoVecTM (Invivogen #lyec-12 ...
-
bioRxiv - Immunology 2024Quote: ... Matched negative controls ODN 5328 (InvivoGen) or CL075 (InvivoGen ...
-
bioRxiv - Systems Biology 2023Quote: ... and as a negative control Ovalbumin (InvivoGen) were coupled to uniquely coded beads (xMAP MagPlex Microspheres ...
-
bioRxiv - Immunology 2023Quote: ... was coupled to 100 ng/IP Poly(I:C) (HMW) Biotin (Invivogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Ultrapure biotin-LPS that activates only TLR4 pathway was purchased from InVivoGen. To analyze LPS binding ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... For control purposes cells were stimulated with cytosolic 1 µg LPS using lipofectamine or nigericin (6.7 µM) (InvivoGen, tlrl-nig). 1% triton X100 was used as a lysis control in cell death assays (37) ...
-
bioRxiv - Pathology 2020Quote: ... reporter gene under the control of an IFN-β minimal promoter fused to five NF-κB and AP-1-binding sites (Invivogen).
-
bioRxiv - Immunology 2023Quote: ... treated with CM 1:1 diluted in fresh cell growth media or PC (positive control: 1 μg/ml TLR-2 ligand Pam3CSK4 and 100 nM TLR-9 ligand CpG ODN 1668, both InvivoGen, USA). For experiments with different glucose concentrations ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µg/ml TriDAP (positive control for NOD1/NULL1) (InvivoGen) or 10 µg/ml muramyl dipeptide (MDP ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of three to five control shRNAs (Invivogen) and a blasticidin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Eluted fractions were analyzed by western blotting with a mouse monoclonal RBD-specific antibody (InvivoGen, Cat# srbdmab10). Peak fractions were then pooled and dialyzed against PBS in 10,000 molecular weight cutoff (MWCO ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted fractions were analyzed by western blotting with a mouse monoclonal RBD specific antibody (InvivoGen, Cat# srbd-mab10). Peak fractions were then pooled and dialyzed against PBS in 10,000 molecular weight cutoff (MWCO ...
-
bioRxiv - Microbiology 2020Quote: ... Control mice received PBS or alum in the form of Alhydrogel (InVivogen) diluted in PBS (n = 20-25 mice/group) ...
-
bioRxiv - Bioengineering 2020Quote: ... The Fc control protein was derived from the pFuse-IgG1e3-Fc2 (InvivoGen). For the generation of full length PSG1-Fc and PSG9-Fc ...
-
bioRxiv - Neuroscience 2021Quote: ... Wako Chemicals) and rat anti-mouse Clec7a (activated microglia; 1:50; InvivoGen, CA, USA) in 2% NDS and PBS-T for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/ml muramyl dipeptide (MDP; positive control for NOD2/NULL2) (InvivoGen), 10 µg/ml Tri-Lys (negative control for NOD1/NULL1 ...
-
bioRxiv - Immunology 2020Quote: ... 20 μL Flagellin from Salmonella typhimurium as a control (Standard FLA-ST (Invivogen) or leptospires resuspended in PBS at a MOI between 1:50 to 1:200 were added in empty wells ...
-
bioRxiv - Immunology 2020Quote: ... and two healthy control (HC) donors were treated with STING inhibitor H-151 (5μM, InvivoGen) at 37°C for 4 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Scrambled control ssRNA (Table S2) was designed using siRNA wizard software (Invivogen, San Diego CA).