Labshake search
Citations for Invivogen :
1 - 50 of 110 citations for Ion Exchange Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... and 50ug/ml ionomycin (Invivogen; inh-ion) in complete RPMI media for 6 h at 37°C prior to infection with dengue immune complexes.
-
bioRxiv - Immunology 2023Quote: ... with 1 µg/mL Ionomycin (inh-ion; Invivogen) were also included as negative and positive controls respectively ...
-
bioRxiv - Microbiology 2022Quote: ... growth media were replaced with HEK-blue detection media (Invivogen hb-det2) for SEAP assessment ...
-
bioRxiv - Cancer Biology 2020Quote: ... media containing primocin (InVivoGen). For xenograft implantation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The following day media was exchanged with media containing 0.15mg/mL ganciclovir (InvivoGen). Magnet stimulated cells were then placed under constant magnetic stimulation for 72 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... The media was replaced with selection media containing 0.005 mg/mL Blasticidin (InvivoGen ant-bl-5b) and 0.1 mg/mL Zeocin (InvivoGen ant-zn-5b) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultures were maintained in media containing 50% WRN conditioned media supplemented with 1mg/mL primocin (InvivoGen), 1mM N-Acetylcysteine ...
-
bioRxiv - Bioengineering 2020Quote: ... and HEK blue selection media (Invivogen). For assays ...
-
bioRxiv - Molecular Biology 2019Quote: ... media were supplemented with puromycin (InvivoGen) at 1 µg/ml or 6-thioguanine (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfection media was aspirated and reduced serum media with 10 μg/mL of Poly(I:C) (InvivoGen, California, USA) was added to the cells for three days ...
-
bioRxiv - Developmental Biology 2020Quote: ... selection media containing 300ng/ml puromycin (InvivoGen) was applied to the cells for 48 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... in mTeSR1 media with 0.2% Normocin (Invivogen). For routine maintenance ...
-
bioRxiv - Systems Biology 2023Quote: ... Transfected cells were incubated for 24 hours before transfection media was replaced with media containing 10 ug/ml blasticidin (Invivogen). Cells were incubated for 30 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell media included Plasmocin (Invivogen ant-mpt) to prevent mycoplasma growth and antibiotics/antimycotics to prevent bacterial and fungal contamination ...
-
bioRxiv - Genetics 2022Quote: ... Media was mixed with Gold-Lucia substrate (Invivogen) before measurement using a plate reader.
-
bioRxiv - Biochemistry 2024Quote: ... and the media were supplemented with Normocin (Invivogen) during transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... Media was removed prior to the addition of heat-inactivated serum diluted 1:20 in HEK Blue Detection media (Invivogen, #hb-det3). Cells were incubated for 48 hours and then absorbance was measured at 630 nm with a plate reader (SpectraMax) ...
-
bioRxiv - Developmental Biology 2024Quote: ... TS Complete media containing 100 µg/mL Primocin (InvivoGen), 0.15% BSA (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Media was collected and combined with QUANTI-Blue substrate (Invivogen) to assess secreted alkaline phosphatase (SEAP ...
-
bioRxiv - Immunology 2021Quote: ... in HEK-Blue detection media (InvivoGen, Cat. no.# hb-det3) along with the mentioned amounts of test protein ...
-
bioRxiv - Cell Biology 2023Quote: ... media was further supplemented with 200 μg/mL G418 (Invivogen) and 3 μg/mL puromycin (Invivogen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and CaV3.3 were passaged in media with 15μg/ml Blasticidin (InvivoGen) and 100μg/ml Hygromycin ...
-
bioRxiv - Biophysics 2021Quote: ... Media was supplemented with 5 µg/ml Plasmocin (Cat# ant-mpp, InvivoGen) as a prophylactic against mycoplasma contamination.
-
bioRxiv - Cell Biology 2021Quote: ... Positive cells were selected with media containing 1.5 mg/mL hygromycin (InvivoGen) and 150 µg/mL blasticidin (InvivoGen ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293FT cells were maintained in G418-containing media (500 μg/mL; Invivogen). Experiments involving doxycycline-inducible ...
-
bioRxiv - Cell Biology 2022Quote: Tracheal explants were incubated with DMEM/F-12 Media with Primocin (InVivoGen) and 15 mM HEPES ...
-
bioRxiv - Cancer Biology 2022Quote: ... the previous media was supplemented with antibiotics 100 ug/ml Primocin (Invivogen), 100 ug/ml Normocin (Invivogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... and media were supplemented with normocin (100 ug/mL) during transfection (Invivogen). For lysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... the previous media was supplemented with antibiotics 100 ug/ml Primocin (Invivogen), 100 ug/ml Normocin (Invivogen) ...
-
bioRxiv - Immunology 2022Quote: ... Then 20µL of the culture media was added to QUANTI- Blue substrate (InvivoGen) for 1.5hr and absorbance was measured at 620nm (bio-tek ...
-
bioRxiv - Genomics 2020Quote: ... fresh mESC media was added to the cells with 10μg/ml blasticidin (InvivoGen) and 1μg/ml puromycin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... airway organoid complete media was supplemented with 10 μg ml−1 Normocure (InvivoGen) and 2.5 μg ml−1 Fungin (InvivoGen ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were selected with media supplemented with puromycin (InvivoGen, cat# ant-pr-1) for a few days and single colonies were selected.
-
bioRxiv - Systems Biology 2023Quote: ... cells were placed under selection with media containing 10 ug/ml Blasticidin (Invivogen). After 2 cell passages in selection media ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept in media with 1 µg/mL Puromycin (Invivogen, ant-pr-1). To induce LRP10 expression ...
-
bioRxiv - Cell Biology 2022Quote: ... The tracheas were placed on ice in DMEM/F-12 Media with Primocin (InVivoGen) and 15 mM HEPES until culture ...
-
bioRxiv - Cell Biology 2021Quote: All source cell culture was maintained in media containing plasmocin (1:5000 dilution, Invivogen) to prevent mycoplasma contamination ...
-
bioRxiv - Molecular Biology 2020Quote: ... according to the manufacturer’s instructions and media were supplemented with Normocin during transfection (Invivogen).
-
bioRxiv - Immunology 2021Quote: ... Recovered larvae were washed with RPMI 1640 and resuspended in media containing Primocin (InvivoGen).
-
bioRxiv - Cell Biology 2022Quote: ... 1x pen/strep (complete explant culture media) and 1x Normocin (InvivoGen, # Ant-nr-1) for 12-14 days in T-75 culture flasks ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Microbiology 2023Quote: ... followed by continued maintenance in cell culture media supplemented with 10µg/mL Blasticidin (InvivoGen).
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... BMDMs were mock treated (media only) or stimulated with 100 ng/mL of LPS (InvivoGen) for 4 h ...
-
bioRxiv - Physiology 2020Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). The CHO-K1 cells stably expressing HCN4 were grown in Ham’s F12 medium with L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... All culturing media were supplemented with plasmocin (2.5 μg/mL; Invivogen, San Diego, California, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Physiology 2021Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). HEK 293 cells were negative for mycoplasma infection ...
-
bioRxiv - Immunology 2020Quote: ... Slices were cultured overnight in complete media supplemented with 10 µg/mL OVA protein (Invivogen) or PBS ...
-
bioRxiv - Immunology 2021Quote: ... SEAP amounts were then measured in the cell culture supernatants using Quanti-Blue Detection Media (InvivoGen) according to manufacturer’s instructions ...