Labshake search
Citations for Invivogen :
1 - 50 of 150 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Human cGAS (hcGAS) and murine cGAS (mcGAS) plasmids were purchased from Invivogen. Flag-cGAS and V5-cGAS were amplified by PCR and were cloned into pcDNA3.2-DEST plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of three to five control shRNAs (Invivogen) and a blasticidin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The 279bp human AldA enhancer was PCR amplified from the pDRIVE5-GFP-10 plasmid (Invivogen). The HCMV enhancer was PCR amplified from the pDrive5 GFP-1 Promoter Test (Invivogen) ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
bioRxiv - Bioengineering 2022Quote: ... Human codon optimized Delta full-length SARS-CoV-2 Spike protein plasmid was synthesized by Invivogen (plv-spike-v8).
-
bioRxiv - Immunology 2019Quote: ... 293/NOD2 cells were obtained by stable transfection of HEK293 cells with the pUNO-hNOD2 plasmid which expresses the human NOD2 gene (Invivogen). THP1 cells were obtained from ATCC.
-
bioRxiv - Developmental Biology 2021Quote: shRNAs were designed based on (He et al., 2018) and using the siRNA Wizard from Invivogen (available at https://www.invivogen.com/sirnawizard/design_advanced.php) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Molecular Biology 2022Quote: ... the FTO-targeting and Control shRNAs were designed in silico with Blastn (NCBI) and siRNA wizard (Invivogen) online tools ...
-
bioRxiv - Neuroscience 2020Quote: ... because we were not able to identify a specific shRNA target sequence using web-based design tools (InvivoGen siRNA Wizard ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Immunology 2022Quote: ... and human IL-1β (Invivogen), were dissolved in PBS and added to the cell culture medium to achieve final concentrations of 10 μM (ADP-heptose) ...
-
bioRxiv - Immunology 2023Quote: ... human p21 (Invivogen; 100 ng), human p27 (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... human p27 (Invivogen; 500 ng), and SV40 large T antigen (20 ng ...
-
bioRxiv - Immunology 2023Quote: ... the human cDNA sequence (Invivogen) was subcloned into the pcDNA3 vector between the HindIII and EcoRV restriction sites followed by transfection of 5 µg plasmid into BAFF/CD40L double positive fibroblasts using Lipofectin reagent (Thermo) ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid and Poly I:C (InvivoGen) transfections were done using Lipofectamine-2000 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... IgG4 using IgG plasmids (Invivogen) by conventional cloning techniques as previously described (35 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid pUNO1-hCIITA (InVivogen, Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... combined with pFUSE-based plasmids (InvivoGen) encoding both heavy (HC ...
-
bioRxiv - Immunology 2023Quote: ... and ligated into pUNO1 plasmid (Invivogen) using T4 DNA ligase (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: The pFUSE-CHIg-mG2a plasmid (InvivoGen) containing the 602 heavy chain variable region was used for the generation of Fc variant antibodies ...
-
bioRxiv - Immunology 2022Quote: cDNA encoding a truncated human ACE2 fused to human albumin was sub-cloned into pFUSE2ss-CLIg-hk (InvivoGen). The vector was transiently transfected into Expi293F cells in suspension (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Immunology 2021Quote: ... In some assays human anti-RBD (Invivogen) of known antibody concentration was used as standard ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids or poly(I:C) (Invivogen, tlrl-pic) were transfected using either Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: Anti-human CD20 murine IgG2a (hcd20-mab10, InvivoGen) and mouse anti-Biotin mIgG2a [3E6] (ab36406 ...
-
bioRxiv - Cell Biology 2021Quote: ... Human TMPRS2 (pUNO1-hTMPRSS2a) was ordered from InvivoGen. Full length SARS-CoV-2 Spike plasmid (VG40589-UT ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... Recombinant human TNF-α was purchased from InvivoGen. The antiretroviral drugs efavirenz ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 and TMPRSS2a (Invivogen) were seeded at 20,000 cells/well in a gelatin-coated 96-well plate (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: A plasmid encoding full-length gp130 (WTgp130; InVivoGen) was used to create the 5 mutants ...
-
bioRxiv - Microbiology 2022Quote: ... pVitro2-neo-mcs plasmid (InvivoGen, San Diego, USA) and S52/SG-Feo(AI ...
-
bioRxiv - Immunology 2023Quote: ... or the mouse kappa light chain plasmid (InVivoGen). The gBlock DNA and plasmids were cut with the specified enzymes ...
-
bioRxiv - Bioengineering 2020Quote: ... Single chain human IL-12 was purchased from Invivogen. Blinatumomab (anti-hCD19-CD3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or HRP-conjugated anti-human IgG Fc (Invivogen; 31413). Proteins from transient transfections were either purified via His-tag or Protein A purification ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HRP-conjugated anti-human IgG Fc antibodies (Invivogen; 31413) were used for detection ...
-
bioRxiv - Microbiology 2024Quote: ... human carcinoma epithelial lung A549 (Invivogen Inc, Toulouse, France), and Monkey kidney normal Vero E6 (CCL-81 ...
-
bioRxiv - Microbiology 2024Quote: ... human carcinoma epithelial lung A549 (Invivogen Inc, Toulouse, France), human microglial clone 3 HCM3 (ATCC ...
-
bioRxiv - Microbiology 2023Quote: Human HepG2 liver carcinoma AhR-Lucia reporter cells (InvivoGen) were cultured according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen). Recombinant protein was produced by transient transfection of Expi293 cells and purified using HiTrap Protein A column ...
-
bioRxiv - Microbiology 2022Quote: ... and then cloned in the pTRIOZ-hIgG1 plasmid (InvivoGen) using the restriction enzymes SgrAI (NEB ...
-
bioRxiv - Immunology 2021Quote: ... reagents in human TLR1-9 Agonist kit (InvivoGen, tlrl-kit1hw) were diluted to working concentration in PBS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of HRP-conjugated anti-human IgG Fc (Invivogen; 31413) diluted 1:5000 in blocking buffer was added to the plates and incubated at room temperature for 1hr ...
-
bioRxiv - Immunology 2021Quote: Antibody variable regions were cloned into expression plasmids from Invivogen (#pfusess-hchg1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14). Wild-type human NIK and the NIK-K429/430A mutant plasmids were a gift from Prof ...
-
bioRxiv - Microbiology 2020Quote: ... serial dilutions of recombinant human IL-1β (Invivogen, San Diego, CA) were added in order to generate a standard curve for each assay ...
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Microbiology 2022Quote: A549-hACE2 lung carcinoma cells expressing the human ACE2 protein (Invivogen) were maintained in DMEM with 4.5 g/L glucose and 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... serial dilutions of recombinant human IL-1β (Invivogen, San Diego, CA) were added to generate a standard curve for each assay ...
-
bioRxiv - Immunology 2023Quote: ... IgG3 concentrations were measured by an IgG3 Human ELISA Kit (Invivogen).