Labshake search
Citations for Invivogen :
1 - 50 of 201 citations for Hepatitis B Virus E Antigen HBeAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Each immunization consisted of 200 μl of antigen/adjuvant mix containing 50 μg of vaccine antigen and 100 μl of AddaVax adjuvant (Invivogen) via the subcutaneous (s.c. ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... LPS (from E. coli K12, Invivogen) was dissolved in RPMI and used at a final concentration of 100ng/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Microbiology 2023Quote: ... 20 μg of the antigen complexed with Alhydrogel 2% (Invivogen) as adjuvant was injected intramuscularly per mouse using a 22-23 gauze needle syringe ...
-
bioRxiv - Immunology 2023Quote: ... the antigen was added to physiological water (InvivoGen, vac-phy) and mixed with adjuvant system 04 (AS04 ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Neuroscience 2020Quote: ... LPS (LPS from E. coli O111:B4) (Invivogen), polyinosinic:polycytidylic acid (Invivogen) ...
-
bioRxiv - Microbiology 2020Quote: ... virus stocks were confirmed to be free of mycoplasma (PlasmoTest, InvivoGen) and other adventitious agents by deep sequencing on a MiSeq platform (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Immunology 2022Quote: ... Ultrapure LPS (E. coli 0111:B4) was purchased from Invivogen. MitoTEMPO and UK-5099 were purchased from Sigma Aldrich (SML0737 ...
-
bioRxiv - Microbiology 2022Quote: ... The vaccine formulation was prepared by combining 20μg purified antigen with either 100μg Alum (InvivoGen), Montanide W/O/W ISA 201 VG (Sappec ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg of M2ex3 antigen + 40 μg CpG (oligonucleotide 1826, a TLR9 agonist from InvivoGen), or 2 μg of M2ex3 + 40 μg STING agonist (2’3’-c-di-AM(PS)2(Rp,Rp) ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and LPS (100 ng / mL E. coli K12, k-eklps, Invivogen) with IFNγ (20 ng / mL ...
-
bioRxiv - Immunology 2019Quote: ... or LPS (O111:B4, E. coli, 1µg/2,5×105 cells Invivogen) was achieved using FuGeneHD (Promega ...
-
bioRxiv - Immunology 2023Quote: ... and LPS-EB (E. coli 0111:B4) were purchased from InvivoGen.
-
bioRxiv - Immunology 2023Quote: ... group E mice were treated with dexamethasone (1 mg/kg, InvivoGen) intraperitoneally once daily from day 12 to 15 ...
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... The protein antigen was adjuvanted with AddaVax (1:1 v/v; vac-adx-10, InvivoGen, USA) for immunisation.
-
bioRxiv - Immunology 2020Quote: ... Mice were immunized via subcutaneous injection of 10 µg antigen with 10 µg Quil-A (InVivogen) and 10 µg monophosphoryl Lipid A (InVivogen ...