Labshake search
Citations for Invivogen :
1 - 50 of 224 citations for Cytomegalovirus Glycoprotein B gB Mouse Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Bioengineering 2022Quote: ... For FCM assay using hACE2-Fc (Invivogen, Catalogue code: fc-hace2), 5μL of the protein was incubated for 1 hour at 4°C with the cells using a similar assay condition described above ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... fused with the cDNA sequence of the mouse hinge and IgG2a heavy chain Fc region (pFUSE-mIgG2a-Fc1, InvivoGen), downstream of a mouse Ig kappa chain secretion signal peptide and was subcloned into a pMSGV retroviral vector followed by enhanced (e)GFP reporter gene cassette using PCR and standard molecular cloning techniques to generate pMSGV-A4-Fc-T2A-eGFP ...
-
bioRxiv - Microbiology 2023Quote: ... Soluble hACE2-Fc (fchace2, InvivoGen), a recombinant protein consisting of the extracellular domain of human ACE2 fused to a human IgG1 Fc region ...
-
bioRxiv - Molecular Biology 2024Quote: ... in the presence or absence (gB-C7 only) of CpG 1018 adjuvant (10 mg; Dynavax) and aluminum hydroxide (alum; Alhydrogel®; 50 mg; InvivoGen). Immunogens were prepared by first mixing gB protein with alum for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble Fc-mDectin-1a containing the C-terminal extracellular domain of mouse Dectin-1a fused with the human IgG1 Fc domain was purchased from Invivogen. Overnight C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... were infected with either 30 μl of 500 TCID50 mouse-adapted PR8-HA-GP61-80 or 2×105 PFU of LCMV Armstrong by intranasal inoculation or immunized by intramuscular (quadriceps) injection with 2 μg LCMV recombinant glycoprotein (rGP) with addition of Addavax (InvivoGen) adjuvant at a 1:1 ratio ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Immunology 2020Quote: ... Anti-human IgG Fc Capture (AHC) Biosensors tips were initially loaded with Dectin-1A:FC fusion protein (Invivogen, #fc-hdec1a) at 13 ug/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... ACE2-8xHis-AviTag plasmids were generated by subcloning the Spike-RBD or ACE2 DNA fragment into a pFUSE-hIgG1-Fc-AviTag vector (adapted from the pFUSE-hIgG1-Fc vector from InvivoGen). The ACE2-Fc-LgBiT fusion plasmids were generated by subcloning the gene fragments of LgBiT to the N- or C-terminus of the ACE2-TEV-Fc-AviTag vector with a 10-amino acid (N-terminal fusion ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... VH-Fc were cloned into a pFUSE (InvivoGen) vector with a human IgG1 Fc domain ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or HRP-conjugated anti-human IgG Fc (Invivogen; 31413). Proteins from transient transfections were either purified via His-tag or Protein A purification ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HRP-conjugated anti-human IgG Fc antibodies (Invivogen; 31413) were used for detection ...
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Microbiology 2019Quote: ... Mice were also subcutaneously immunized with 20 μg of Gn-Fc or Gc-Fc protein absorbed in aluminum hydroxychloride (Alhydrogel® adjuvant 2%, InvivoGen, Hong Kong). Mice sera were collected from immunized mice at one week after the third immunization to determine the levels of specific antibody titers ...
-
bioRxiv - Immunology 2020Quote: ... + 1% FCS and treated with 500 ng/mL Pam3CSK4 (InvivoGen) for 4 hours and 10 μM nigericin (InvivoGen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of HRP-conjugated anti-human IgG Fc (Invivogen; 31413) diluted 1:5000 in blocking buffer was added to the plates and incubated at room temperature for 1hr ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Western blots using HRP-conjugated anti-human IgG Fc (Invivogen; 31413) diluted 1:10000 in blocking buffer ...