Labshake search
Citations for Invivogen :
1 - 50 of 1726 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines transfected with the pMOT-4H plasmid (Oberholzer et al 2006) were grown with 25 ug/ml of hygromycin B Gold (Invivogen).
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Microbiology 2019Quote: ... Miltenyi, 1000U/mL) and interleukin-4 (IL-4, Miltenyi, 1000U/mL) for 5 days before addition of lipopolysaccharide (LPS, Invivogen, 50 ng/mL) for 2 further days.
-
bioRxiv - Immunology 2020Quote: ... and selected with 4 μg mL−1 puromycin (InvivoGen) for two weeks.
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 mg/kg anti-CTLA-4 (clone 9D9, cat. mctla4-mab10, InvivoGen). Antibodies were administered twice weekly for a maximum of four weeks.
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Plant Biology 2021Quote: ... Transgenic Col-0 (LUC) plants were selected on 1/2 MS medium supplemented with 50 μM hygromycin B (InvivoGen, Cat No. ant-hg-5). LUC activity was confirmed as described above ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... + 4 μg/ml Blasticidin (Invivogen). In order to knock-out SLX4 gene in these cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/μL Zeocin (Invivogen) were added to culture media ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10% fetal bovine serum (FBS) and 10 µg/mL Hygromycin B (InvivoGen) at 37°C in 5% CO2 ...
-
bioRxiv - Physiology 2019Quote: ... and 4 µg/ml blasticidin (InvivoGen). Monoclonal cell lines were tested for robust expression of E2GFP and FaNaC by fluorescence microscopy and patch clamp electrophysiology ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2023Quote: ... treated with CM 1:1 diluted in fresh cell growth media or PC (positive control: 1 μg/ml TLR-2 ligand Pam3CSK4 and 100 nM TLR-9 ligand CpG ODN 1668, both InvivoGen, USA). For experiments with different glucose concentrations ...
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Stable transfectants obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/mL Hygromycin B Gold (Invivogen, 31282-04-9). HeLa cells were cultured in DMEM supplemented with 10% Fetal Bovine Serum and Penicillin-streptomycin 100units/ml at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg cGAMP (Invivogen, San Diego, Californien, USA), 4 µg c-di-UMP (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... and assayed with QUANTI-Luc 4 reagent (Invivogen). Luminescence was read immediately with an Envision system.
-
bioRxiv - Immunology 2023Quote: ... selective medium containing Puromycin (4 μg/ml, InvivoGen) was added and after 7 days cells were sorted using FACS Aria (BD ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 10 days or 2 μg/mL puromycin (InvivoGen; #ant-pr-1) for 4 days to generate stable cell lines.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... One replicate received 1 μg/mL puromycin (Invivogen). After 3 days ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...