Labshake search
Citations for Invivogen :
1 - 50 of 799 citations for 7 TRIFLUOROMETHYL 2 3 4 5 TETRAHYDRO 1H BENZO B AZEPINE HYDROCHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Cell Biology 2022Quote: ... the cationic lipid-based transfection reagent LyoVec and cyclic [G(2’,5’)pA(3’,5’)p] (2’3’-cGAMP) were obtained from Invivogen (San Diego, USA) and Lipofectamine2000 was obtained from ThermoFisher Scientific (Dreieich ...
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Immunology 2021Quote: ... Labeled cells (0.5x106 cells/mL) were cultured for 2-3 days with 5 μg/mL R848 (InvivoGen), 50 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Plant Biology 2021Quote: ... Transgenic Col-0 (LUC) plants were selected on 1/2 MS medium supplemented with 50 μM hygromycin B (InvivoGen, Cat No. ant-hg-5). LUC activity was confirmed as described above ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Immunology 2020Quote: ... plus the TLR-7 and TLR-8 agonist Resiquimod (R848, 2 µM, InvivoGen), for 24 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Immunology 2022Quote: ... for 3 hr followed by (flagellin isolated from P. aeruginosa, 2 or 5 µg/mL) for 3 hr using FLA-PA Ultrapure (InvivoGen, tlrl-pafla) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen. EFV was purchased from Bristol-Myers Squibb.
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... Elution was performed with free 2′3′-cGAMP (100 μM; InvivoGen), 3′3′-cGAMP (100 μM ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2021Quote: ... for TLR1/2 stimulation or 5 ng/mL Pam2CSK4 (Invivogen) for TLR2/6 stimulation was added for 4 hrs after which the culture was topped up with RF10+IL-3 to a final volume of 1 mL ...
-
bioRxiv - Immunology 2023Quote: ... or 2 µg/mL poly(I:C) (Invivogen (trl-pic-5). After 24 hours incubation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected for 3 weeks using puromycin (5 μg/mL,-InvivoGen).
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... Infected cells were selected using puromycin for 3 days (2 µg/ml, InvivoGen) or hygromycin B for 7 days (500 µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Microbiology 2023Quote: ... S10-3 WT cells were transduced with pTRIPZ-Rab5/7/11-GFP or EGFP-LAMP1 and selected in cDMEM supplemented with 2 μg/ml puromycin (Invivogen).
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Immunology 2023Quote: ... The Class C CpG ODN_2395 sequence (5’-TCGTCGTTTTCGGCGCGCGCCG-3’) was obtained from Invivogen (#tlrl-2395). We used the crystal structure of mouse TLR9 extracellular domain (TLR9 ECD ...
-
bioRxiv - Microbiology 2019Quote: ... Miltenyi, 1000U/mL) and interleukin-4 (IL-4, Miltenyi, 1000U/mL) for 5 days before addition of lipopolysaccharide (LPS, Invivogen, 50 ng/mL) for 2 further days.
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...